Actias selene

Hübner, 1806 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Actias

At a glance

Occurrence records813

Data sources6

Biological traits0

DNA specimens51

eDNA detections2

Sources6 archives

Databases and archives Actias selene's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF813 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD51 specimens

01Narrative

Actias selene est une espèce de papillons de la famille des Saturniidae, dont le nom vernaculaire est Papillon lune indien. Il est populaire chez les entomologistes amateurs ou dans certaines fermes à papillons qui en achètent des œufs ou des cocons pour les faire éclore. Ce type de pratique pouvant être une menace si les individus sont prélevés dans la nature. Cependant, l'élevage est très aisé sur nombre de plantes hôtes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actias selene has left across the world's sequence archives.

At a glance

DNA specimens51

BINs2

Marker genes1

eDNA detections2

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

70Amostly conserved

88Amostly conserved

92Tmostly conserved

220Cmostly conserved

268Cmostly conserved

361Cmostly conserved

376Tmostly conserved

400Tmostly conserved

403Tvariable

415Gmostly conserved

466Amostly conserved

547Tmostly conserved

550Tmostly conserved

574Amostly conserved

601Tmostly conserved

610Tvariable

616Cmostly conserved

622Gmostly conserved

628Avariable

631Gvariable

640Cmostly conserved

643Tmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGCCTCCTTATTCGAGCAGAATTAGGTACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes23

BINs2

Most divergent pair7.9%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actias brevijuxtasame genus4.0%Actias seitzisame genus5.0%Actias gnomasame genus7.0%Actias ningpoanasame genus7.3%Actias xeniasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_018133 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type813 records

Wild obs. + sensor694

Museum / vouchered119

Range

Area of Occupancy AOO2 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 177≤1 km 175≤10 km 89>10 km 61

502 georeferenced · 192 without coordinates

Open the mapobservation + sensor694

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 4≤10 km 7>10 km 3

14 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FACTlocation not on record	51
Paris, FR	19
National Museum of Natural Sciencelocation not on record	14
ZSMlocation not on record	4
New Haven, US	4
Helsinki, FI	4
Toronto, CA	4
Natural History Museum of Utahlocation not on record	2
Zürich, CH	2
Banyoles, ES	2
Auckland, NZ	2
Iwate Prefectural Museumlocation not on record	1
Chicago, US	1
Loyola College, Entomology Research Institutelocation not on record	1

14 institutions · 111 of 119 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Actias selene was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 18.8–20.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)24.1 °C 22.9–25.3

Min temp (night)13.9 °C 13.5–14.3

Precipitation161 mm/mo 78.8–243

Air humidity60.0 % 54.4–65.6

Moisture balance28.6 mm/mo -70.0–127

Vapour deficit910 Pa 749–1,072

Wind speed1.30 m/s 1.20–1.40

Cloud cover23.7 % 12.6–34.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)