Actias gnoma

Butler, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Actias

At a glance

Occurrence records658

Data sources7

Biological traits0

DNA specimens16

eDNA detections16

Sources7 archives

Databases and archives Actias gnoma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility658 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF658 records

Environmental DNA1 datasets · 3 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Actias gnoma, the Japanese moon moth, is a moth in the family Saturniidae The species was first described by Arthur Gardiner Butler in 1877. It is found in Japan and the Russian Far East. Adults are light greenish blue with a raised and sparse scale cover. A single postmedial fascia is found on the forewings. The eyes are small, mostly with a fine black frame (although this is sometimes absent). The inner half of the eye is narrower than the outer one. The apex of the hindwings is usually pointed.(2011). "The Actias Leach, 1815, in the Far East: how many species?". Neue Entomologische Nachrichten. 67: 40-56.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actias gnoma has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes2

eDNA detections16

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

20Gmostly conserved

37Amostly conserved

92Tmostly conserved

200Gmostly conserved

278Cmostly conserved

337Tmostly conserved

448Cmostly conserved

475Cvariable

655Tmostly conserved

AACTTTATACTTCATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGTACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes8

BIN1

Most divergent pair0.76%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actias ningpoanasame genus3.6%Actias laovietasame genus3.8%Actias callandrasame genus6.4%Actias ebertisame genus6.7%Actias dulcineasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type658 records

Wild obs. + sensor578

Museum / vouchered80

Range

Area of Occupancy AOO1 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 59≤1 km 11≤10 km 4>10 km 52

126 georeferenced · 452 without coordinates

Open the mapobservation + sensor578

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 3≤1 km 8>10 km 2

13 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	35
Gifu prefectural Museumlocation not on record	20
Tartu, EE	8
Hiwa Museum of Natural Historylocation not on record	3
Paris, FR	3
YPIMlocation not on record	3
New Haven, US	2
Nagatoro-machi, Chichibu-gun, JP	2
IJIBlocation not on record	1
GCSMlocation not on record	1

10 institutions · 78 of 80 vouchered records shown · 2 without an institution code

09Environmental DNA16 detections

Where the DNA of Actias gnoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.9–22.6

Seasonal swing summer↔winter24.5 °C

Max temp (day)21.1 °C 16.5–26.4

Min temp (night)11.4 °C 9.80–18.7

Precipitation199 mm/mo 167–256

Air humidity64.7 % 59.7–67.6

Moisture balance114 mm/mo 34.9–155

Vapour deficit774 Pa 558–1,002

Wind speed1.80 m/s 1.60–3.60

Cloud cover45.2 % 29.5–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)