Actias ningpoana

Felder, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Actias

At a glance

Occurrence records1 284

Data sources7

Biological traits0

DNA specimens136

eDNA detections130

Sources7 archives

Databases and archives Actias ningpoana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 284 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI130 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics136 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 284 records

Environmental DNA1 datasets · 4 countries130 detections

DNA & barcodingBOLD136 specimens

01Narrative

Actias ningpoana, the Chinese moon moth, is a moth of the family Saturniidae. The species was first described by father-and-son entomologists Cajetan and Rudolf Felder in 1862. It is quite large, and has long, curved, hindwing tails. There are many congeners across Asia; the Luna moth (A. luna) of Eastern Canada and the United States is a close relative.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding136 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actias ningpoana has left across the world's sequence archives.

At a glance

DNA specimens136

BINs2

Marker genes11

eDNA detections130

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus122 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

139Cmostly conserved

163Cvariable

172Tmostly conserved

199Gmostly conserved

265Gmostly conserved

271Cmostly conserved

340Cmostly conserved

370Amostly conserved

376Tmostly conserved

433Gmostly conserved

460Tmostly conserved

478Tvariable

484Amostly conserved

514Avariable

577Amostly conserved

578Cvariable

598Amostly conserved

619Cmostly conserved

622Tmostly conserved

AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGTACCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes39

BINs2

Most divergent pair2.6%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actias laovietasame genus2.4%Actias gnomasame genus3.6%Actias callandrasame genus6.7%Actias ebertisame genus6.7%Actias artemissame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

08Occurrence & distribution

Record type1 284 records

Wild obs. + sensor1 282

Museum / vouchered2

Range

Area of Occupancy AOO3 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 454≤1 km 210≤10 km 116>10 km 172

952 georeferenced · 330 without coordinates

Open the mapobservation + sensor1 282

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	2

1 institutions · 2 of 2 vouchered records shown

09Environmental DNA130 detections

Where the DNA of Actias ningpoana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found130

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 130 detections have coordinates

Open the map4 countries0

Subtropical forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 11.9–25.0

Seasonal swing summer↔winter17.1 °C

Max temp (day)23.2 °C 15.0–28.5

Min temp (night)16.4 °C 6.70–22.2

Precipitation175 mm/mo 42.0–403

Air humidity63.6 % 59.0–70.0

Moisture balance61.1 mm/mo -33.2–276

Vapour deficit811 Pa 474–1,183

Wind speed2.40 m/s 1.50–4.00

Cloud cover46.3 % 31.8–67.4

CHELSA 1981–2010, ~9 km grid, at location & month of 100 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Actias ningpoana

At a glance

Sources7 archives

At a glance

Record type1 284 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 1 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 284 records