Actias artemis

Bremer & Grey, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Actias

At a glance

Occurrence records923

Data sources7

Biological traits0

DNA specimens13

eDNA detections46

Sources7 archives

Databases and archives Actias artemis's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility923 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF923 records

Environmental DNA1 datasets · 6 countries46 detections

DNA & barcodingBOLD13 specimens

01Narrative

Actias artemis is a moth native to Japan, Korea, China, India and Malaysia. The species was first described by Otto Vasilievich Bremer and William Grey in 1853. Actias artemis is a close relative and look-alike of Actias luna, the American Luna moth.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actias artemis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections46

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

13Tmostly conserved

101Gmostly conserved

295Cmostly conserved

412Cmostly conserved

628Amostly conserved

AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGTACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes6

BIN1

Most divergent pair0.30%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Actias gnomasame genus7.0%Actias ningpoanasame genus7.0%Actias dianasame genus7.8%Actias ebertisame genus7.8%Actias isissame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type923 records

Wild obs. + sensor772

Museum / vouchered151

Range

Area of Occupancy AOO2 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 123≤1 km 26≤10 km 37>10 km 19

205 georeferenced · 567 without coordinates

Open the mapobservation + sensor772

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 3≤10 km 3>10 km 6

12 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
IJIBlocation not on record	49
Paris, FR	36
NSMKlocation not on record	25
Sam Noble Oklahoma Museum of Natural Historylocation not on record	8
Philadelphia, US	7
New Haven, US	6
Zürich, CH	5
HUNMlocation not on record	3
Gyeryonsan Natural History Museumlocation not on record	3
Chiba, JP	1
Stockholm, SE	1
Tartu, EE	1
Research Collection of Eric Van Schaycklocation not on record	1
Tomioka, JP	1
GCSMlocation not on record	1

15 institutions · 148 of 151 vouchered records shown · 3 without an institution code

09Environmental DNA46 detections

Where the DNA of Actias artemis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 5.80–24.1

Seasonal swing summer↔winter27.2 °C

Max temp (day)23.4 °C 10.8–27.3

Min temp (night)16.2 °C 0.2–21.8

Precipitation157 mm/mo 80.5–243

Air humidity65.0 % 55.9–69.4

Moisture balance24.4 mm/mo -28.2–108

Vapour deficit833 Pa 352–1,054

Wind speed2.80 m/s 1.70–4.00

Cloud cover44.1 % 39.5–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)