Acrosternum millierei

(Mulsant & Rey, 1866) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Acrosternum

At a glance

Occurrence records1 362

Data sources6

Biological traits0

DNA specimens12

eDNA detections13

Sources6 archives

Databases and archives Acrosternum millierei's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 362 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 362 records

Environmental DNA1 datasets · 6 countries13 detections

DNA & barcodingBOLD12 specimens

01Narrative

Acrosternum (Acrosternum) millierei ist eine Wanzenart aus der Familie der Baumwanzen (Pentatomidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrosternum millierei has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections13

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 92 variable positions, in barcode order

12Cmostly conserved

13Tmostly conserved

30Amostly conserved

45Cmostly conserved

48Tmostly conserved

63Tvariable

66Amostly conserved

73Tmostly conserved

78Gmostly conserved

81Gmostly conserved

105Tmostly conserved

120Tmostly conserved

129Gmostly conserved

132Tmostly conserved

150Tmostly conserved

168Tmostly conserved

192Tmostly conserved

195Amostly conserved

196Cmostly conserved

204Tmostly conserved

205Tvariable

222Amostly conserved

234Cmostly conserved

246Tmostly conserved

258Tmostly conserved

261Gmostly conserved

270Cmostly conserved

273Tmostly conserved

277Tmostly conserved

279Amostly conserved

282Amostly conserved

283Tmostly conserved

286Tmostly conserved

297Amostly conserved

301Cmostly conserved

303Avariable

315Amostly conserved

333Amostly conserved

336Cmostly conserved

342Cmostly conserved

345Tmostly conserved

346Tmostly conserved

357Cmostly conserved

360Gmostly conserved

366Cmostly conserved

372Gmostly conserved

385Tmostly conserved

390Amostly conserved

396Tmostly conserved

399Cmostly conserved

400Tmostly conserved

402Amostly conserved

405Cmostly conserved

406Cmostly conserved

408Amostly conserved

414Amostly conserved

417Amostly conserved

420Cmostly conserved

426Tmostly conserved

427Tmostly conserved

429Amostly conserved

435Tmostly conserved

453Tmostly conserved

468Gvariable

471Amostly conserved

473Cmostly conserved

477Tmostly conserved

483Cmostly conserved

529Tmostly conserved

531Amostly conserved

537Amostly conserved

538Tmostly conserved

541Tmostly conserved

543Amostly conserved

546Tmostly conserved

547Tmostly conserved

549Amostly conserved

552Tmostly conserved

573Gmostly conserved

577Cmostly conserved

579Gmostly conserved

580Cvariable

582Amostly conserved

597Cmostly conserved

603Gvariable

612Tmostly conserved

615Tmostly conserved

630Amostly conserved

633Tmostly conserved

639Tmostly conserved

648Amostly conserved

652Tmostly conserved

ACTTTATATTTCTTATTTGGAATATGAGCAGGAATAGTAGGATCCGCTATAAGAATAATTATTCGAATTGAATTAGGGCAGCCAGGAAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.2%

Haplotypes6

BINs2

Most divergent pair13.0%

EuropeAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrosternum gramineumsame genus6.2%Acrosternum heegerisame genus9.9%Menida violaceasame family11.6%Eurydema fieberisame family12.0%Eurydema rotundicollissame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 362 records

Wild obs. + sensor1 346

Museum / vouchered16

Range

Area of Occupancy AOO3 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 523≤1 km 203≤10 km 106>10 km 41

873 georeferenced · 473 without coordinates

Open the mapobservation + sensor1 346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 6≤1 km 2≤10 km 1

9 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Private Collection of K. Kalaentzislocation not on record	1
Cape Town, ZA	1
Helsinki, FI	1
NHMOlocation not on record	1

4 institutions · 4 of 16 vouchered records shown · 12 without an institution code

09Environmental DNA13 detections

Where the DNA of Acrosternum millierei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 11.1–28.7

Seasonal swing summer↔winter7.10 °C

Max temp (day)26.8 °C 15.0–34.4

Min temp (night)18.5 °C 7.10–24.8

Precipitation76.5 mm/mo 37.5–263

Air humidity62.5 % 56.9–68.2

Moisture balance-8.00 mm/mo -123–143

Vapour deficit1,233 Pa 462–1,696

Wind speed2.90 m/s 1.90–5.10

Cloud cover31.7 % 13.1–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrosternum millierei

At a glance

Sources6 archives

At a glance

Record type1 362 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 362 records