Acrosternum heegeri

Fieber, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Acrosternum

At a glance

Occurrence records3 884

Data sources6

Biological traits0

DNA specimens9

eDNA detections0

Sources6 archives

Databases and archives Acrosternum heegeri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 884 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 884 records

DNA & barcodingBOLD9 specimens

01Narrative

Acrosternum heegeri ist eine Wanzenart aus der Familie der Baumwanzen (Pentatomidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrosternum heegeri has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.46%

Haplotypes1

BIN1

Where individuals differ — all 9 variable positions, in barcode order

77Gmostly conserved

80Gvariable

230Gvariable

264Tmostly conserved

314Avariable

338Tmostly conserved

377Tmostly conserved

464Amostly conserved

566Cmostly conserved

CTTTATATTTCATATTTGGAATATGAGCAGGAATAGTAGGATCCGCTATAAGAATAATTATCCGAATTGAATTAGGGCAGCCCGGAAGAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrosternum gramineumsame genus9.6%Dalpada neoclavatasame family9.7%Acrosternum milliereisame genus9.9%Menida violaceasame family10.1%Palomena prasinasame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 884 records

Wild obs. + sensor3 853

Museum / vouchered31

Origin

Native2

Introduced4

Range

Area of Occupancy AOO8 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 575≤1 km 464≤10 km 386>10 km 131

2 556 georeferenced · 1 297 without coordinates

Open the mapobservation + sensor3 853

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 18≤1 km 4≤10 km 2

24 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UAclocation not on record	4
Radicondoli, IT	1
Hannam Universitylocation not on record	1

3 institutions · 6 of 31 vouchered records shown · 25 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrosternum heegeri

At a glance

Sources6 archives

At a glance

Record type3 884 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Record type3 884 records