Acrosternum gramineum

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Acrosternum

At a glance

Occurrence records189

Data sources4

Biological traits0

DNA specimens9

eDNA detections8

Sources4 archives

Databases and archives Acrosternum gramineum's data was compiled from.

GBIFGlobal Biodiversity Information Facility189 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF189 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrosternum gramineum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)3.2%

Haplotypes1

BINs2

Where individuals differ — all 86 variable positions, in barcode order

46Tvariable

49Tmostly conserved

56Amostly conserved

61Tmostly conserved

74Tmostly conserved

79Gmostly conserved

85Amostly conserved

94Cmostly conserved

112Cmostly conserved

121Tmostly conserved

130Gmostly conserved

139Cmostly conserved

142Cmostly conserved

154Tmostly conserved

169Tmostly conserved

172Tmostly conserved

175Amostly conserved

184Gmostly conserved

187Tmostly conserved

190Tmostly conserved

196Amostly conserved

197Cmostly conserved

205Cvariable

217Amostly conserved

226Tmostly conserved

235Tvariable

238Cmostly conserved

247Cmostly conserved

259Tmostly conserved

263Tmostly conserved

274Tmostly conserved

283Amostly conserved

286Amostly conserved

307Cmostly conserved

322Amostly conserved

328Tmostly conserved

334Amostly conserved

340Tvariable

343Cmostly conserved

346Tmostly conserved

349Amostly conserved

352Cmostly conserved

355Amostly conserved

362Gmostly conserved

364Amostly conserved

373Gmostly conserved

376Tmostly conserved

379Cmostly conserved

386Tmostly conserved

391Amostly conserved

400Cmostly conserved

406Cmostly conserved

407Cmostly conserved

409Amostly conserved

421Cmostly conserved

433Amostly conserved

436Cmostly conserved

439Gmostly conserved

445Tmostly conserved

469Amostly conserved

474Cmostly conserved

482Tmostly conserved

484Cmostly conserved

487Cmostly conserved

494Amostly conserved

496Tmostly conserved

499Amostly conserved

500Tmostly conserved

502Gmostly conserved

505Cmostly conserved

514Cmostly conserved

517Amostly conserved

520Gmostly conserved

523Tmostly conserved

529Gmostly conserved

542Tmostly conserved

544Amostly conserved

547Tmostly conserved

557Tmostly conserved

565Amostly conserved

568Tmostly conserved

586Tmostly conserved

598Tvariable

610Tmostly conserved

613Tmostly conserved

631Gmostly conserved

AACTTTATACTTCTTATTTGGGATATGAGCAGGAATAGTAGGATCTGCTATAAGAATAATTATTCGAATTGAATTAGGGCAACCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrosternum milliereisame genus6.2%Acrosternum heegerisame genus9.6%Menida violaceasame family11.2%Eurydema maracandicasame family11.4%Eurydema geblerisame family11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type189 records

Wild obs. + sensor188

Other1

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 55≤1 km 34≤10 km 24>10 km 11

124 georeferenced · 64 without coordinates

Open the mapobservation + sensor188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA8 detections

Where the DNA of Acrosternum gramineum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Field, Unknown

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.0–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 28.9–30.5

Min temp (night)19.3 °C 18.8–19.3

Precipitation109 mm/mo 79.1–109

Air humidity52.0 % 52.0–56.9

Moisture balance-17.8 mm/mo -56.1–-17.8

Vapour deficit1,616 Pa 1,315–1,616

Wind speed1.80 m/s 1.80–2.60

Cloud cover25.2 % 25.2–29.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)