Acroricnus seductor — The Life Data

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Acroricnus

At a glance

Occurrence records239

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Acroricnus seductor's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF239 records

DNA & barcodingBOLD5 specimens

01Narrative

Acroricnus seductor is a species of wasp belonging to the family Ichneumonidae.Biolib

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroricnus seductor has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

343Gvariable

527Gmostly conserved

AATTCTATACTTCATTTTTGGCATATGAGCCGGAATATTGGGATCATCTATAAGAATTATTATTCGAATAGAATTAGGTAATCCAGGTAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroricnus stylatorsame genus13.5%Acroricnus ambulatorsame genus13.7%Agrothereutes abbreviatussame family14.3%Gambrus carnifexsame family14.7%Agrothereutes fumipennissame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor239

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 96≤1 km 13≤10 km 61>10 km 6

176 georeferenced · 63 without coordinates

Open the mapobservation + sensor239

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.