Agrothereutes abbreviatus

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Agrothereutes

At a glance

Occurrence records668

Data sources9

Biological traits0

DNA specimens331

eDNA detections1 183

Sources9 archives

Databases and archives Agrothereutes abbreviatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility668 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 183 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics331 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF668 records

Environmental DNA3 datasets · 12 countries1 183 detections

DNA & barcodingBOLD331 specimens

Genome at a glanceGoaT · NCBI≈260 Mbp

01Narrative

Agrothereutes abbreviatus is a species of parasitic wasp belonging to the family Ichneumonidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding331 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agrothereutes abbreviatus has left across the world's sequence archives.

At a glance

DNA specimens331

BINs6

Marker genes1

eDNA detections1 183

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus293 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

1Tmostly conserved

10Cmostly conserved

34Avariable

43Amostly conserved

67Amostly conserved

88Tmostly conserved

94Tvariable

97Cmostly conserved

100Cvariable

106Cmostly conserved

118Tmostly conserved

127Amostly conserved

181Tvariable

202Tvariable

235Cmostly conserved

247Cvariable

262Avariable

265Amostly conserved

289Amostly conserved

322Gvariable

347Cmostly conserved

380Gmostly conserved

403Tmostly conserved

427Tmostly conserved

442Cmostly conserved

448Cmostly conserved

475Tvariable

485Tmostly conserved

508Cmostly conserved

520Amostly conserved

544Amostly conserved

571Cmostly conserved

616Tmostly conserved

625Amostly conserved

628Avariable

631Amostly conserved

634Tmostly conserved

TGTATTATACTTTATTTTTGGTATATGAGCTGGAATATTAGGATCATCTATAAGAATTATTATTCGAATAGAATTAGGTAATCCTGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes40

BINs6

Most divergent pair8.7%

N.AmericaAsiaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agrothereutes fumipennissame genus3.7%Agrothereutes mandatorsame genus6.9%Agrothereutes lanceolatussame genus7.4%Idiolispa analissame family9.5%Hoplocryptus confectorsame family11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Agrothereutes abbreviatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈259 933 491 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Agrothereutes abbreviatus0.26 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type668 records

Wild obs. + sensor306

Museum / vouchered362

Range

Area of Occupancy AOO1 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 86≤1 km 31≤10 km 161>10 km 5

283 georeferenced · 23 without coordinates

Open the mapobservation + sensor306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 7≤1 km 2≤10 km 7>10 km 13

29 georeferenced · 333 without coordinates

Open the institutions mapphysical evidence362

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	131
Stockholm, SE	20
Biodiversity Institute of Ontariolocation not on record	11
NCMGlocation not on record	4
neflocation not on record	3
NHMOlocation not on record	2
MZLUlocation not on record	2
NTNU-VMlocation not on record	1
ZSMlocation not on record	1
WIlocation not on record	1
Tromsø, NO	1
SLU Artdatabankenlocation not on record	1
Kushiro City Museumlocation not on record	1
Bonn, DE	1
Research Collection of M. Alex Smithlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

16 institutions · 182 of 362 vouchered records shown · 180 without an institution code

09Environmental DNA1 183 detections

Where the DNA of Agrothereutes abbreviatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 183

Studies independent surveys3

Countries12

Verifiable raw sequence linked793

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 183 detections have coordinates

Open the map12 countries0

WetlandMixed habitat1. Forest & Woodland|1.1 Boreal ForestGrassland4. Native GrasslandRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 10.5–17.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)17.7 °C 13.5–21.8

Min temp (night)10.0 °C 6.10–13.8

Precipitation88.1 mm/mo 55.2–123

Air humidity59.3 % 55.6–62.4

Moisture balance-22.6 mm/mo -60.7–30.9

Vapour deficit671 Pa 523–809

Wind speed2.70 m/s 1.90–4.30

Cloud cover48.3 % 39.9–59.0

CHELSA 1981–2010, ~9 km grid, at location & month of 1 181 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)