Acroricnus stylator

(Thunberg, 1822) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Acroricnus

At a glance

Occurrence records706

Data sources6

Biological traits0

DNA specimens9

eDNA detections18

Sources6 archives

Databases and archives Acroricnus stylator's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility706 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF706 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acroricnus stylator is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de gewone sluipwespen (Ichneumonidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Thunberg in 1822.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acroricnus stylator has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes2

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 92 variable positions, in barcode order

4Tmostly conserved

10Tmostly conserved

13Tmostly conserved

16Cmostly conserved

28Gmostly conserved

31Cmostly conserved

34Cmostly conserved

43Amostly conserved

49Amostly conserved

58Amostly conserved

59Amostly conserved

74Tmostly conserved

79Cmostly conserved

81Cmostly conserved

88Tmostly conserved

91Tmostly conserved

112Tmostly conserved

133Tmostly conserved

136Cmostly conserved

163Cmostly conserved

170Amostly conserved

205Cmostly conserved

220Cmostly conserved

232Amostly conserved

250Tmostly conserved

259Tmostly conserved

265Tvariable

271Cmostly conserved

274Tmostly conserved

281Tmostly conserved

284Tmostly conserved

287Tmostly conserved

289Gmostly conserved

294Amostly conserved

295Tmostly conserved

300Cmostly conserved

316Tmostly conserved

319Tmostly conserved

322Amostly conserved

336Tmostly conserved

340Cmostly conserved

343Amostly conserved

347Cmostly conserved

349Tmostly conserved

352Tmostly conserved

360Tmostly conserved

361Amostly conserved

364Cmostly conserved

373Tmostly conserved

374Tmostly conserved

376Amostly conserved

380Gmostly conserved

386Cmostly conserved

388Gmostly conserved

389Gmostly conserved

397Cmostly conserved

406Cmostly conserved

412Tmostly conserved

415Tmostly conserved

424Tmostly conserved

436Cmostly conserved

468Tmostly conserved

469Gmostly conserved

473Amostly conserved

474Amostly conserved

477Amostly conserved

480Tmostly conserved

485Tmostly conserved

497Gmostly conserved

506Gmostly conserved

508Tmostly conserved

518Cmostly conserved

526Amostly conserved

529Cmostly conserved

531Tmostly conserved

532Cmostly conserved

544Cmostly conserved

556Cmostly conserved

571Tmostly conserved

574Tmostly conserved

580Tmostly conserved

583Tmostly conserved

592Tmostly conserved

595Tmostly conserved

604Cmostly conserved

616Cmostly conserved

625Amostly conserved

628Amostly conserved

637Cmostly conserved

643Amostly conserved

646Cmostly conserved

653Cmostly conserved

AATTTTATATTTTATCTTTGGAATATGGGCCGGCATATTAGGATCATCAATAAGAATAATTATTCGAATAGAATTAGGCACCCCTGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.7%

Haplotypes4

BINs3

Most divergent pair9.0%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acroricnus seductorsame genus13.5%Acroricnus ambulatorsame genus14.7%Gnotus tenuipessame family16.3%Barichneumon praeceptorsame family16.8%Phygadeuon fumatorsame family16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type706 records

Wild obs. + sensor583

Museum / vouchered123

Range

Area of Occupancy AOO1 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 183≤1 km 67≤10 km 247>10 km 20

517 georeferenced · 66 without coordinates

Open the mapobservation + sensor583

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 57≤1 km 18≤10 km 10>10 km 16

101 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	22
Stockholm, SE	17
Natural History Museum Rotterdamlocation not on record	13
SLU Artdatabankenlocation not on record	10
NHMOlocation not on record	8
neflocation not on record	8
Bonn, DE	6
Gothenburg, SE	2
MNHWlocation not on record	1
Kuopio, FI	1
Tromsø, NO	1
Washington, US	1

12 institutions · 90 of 123 vouchered records shown · 33 without an institution code

09Environmental DNA18 detections

Where the DNA of Acroricnus stylator was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

Grassland1. Forest & Woodland|1.1 Boreal ForestMixed habitat1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 15.3–20.2

Seasonal swing summer↔winter28.8 °C

Max temp (day)23.2 °C 20.0–25.4

Min temp (night)14.0 °C 11.8–16.3

Precipitation92.3 mm/mo 77.7–105

Air humidity59.6 % 57.6–60.5

Moisture balance-44.2 mm/mo -64.6–-11.7

Vapour deficit845 Pa 688–969

Wind speed3.00 m/s 2.50–4.00

Cloud cover42.2 % 39.4–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)