Acronicta longa

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records689

Data sources7

Biological traits0

DNA specimens21

eDNA detections21

Sources7 archives

Databases and archives Acronicta longa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility689 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF689 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Acronicta longa, the long-winged dagger moth, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found across much of North America, with Nova Scotia, Alberta, Florida, and Texas within is range. The wingspan is 32–44 mm. The larvae feed on birch, blackberry, oak and willow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta longa has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

1Amostly conserved

160Gvariable

181Gmostly conserved

238Amostly conserved

312Gmostly conserved

313Cvariable

328Amostly conserved

403Gmostly conserved

457Tmostly conserved

487Cmostly conserved

536Cmostly conserved

553Gmostly conserved

595Tmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes6

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta noctivagasame genus6.5%Acronicta barnesiisame genus7.0%Acronicta perditasame genus7.3%Acronicta rumicissame genus7.3%Acronicta oblinitasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type689 records

Wild obs. + sensor466

Museum / vouchered223

Range

Area of Occupancy AOO2 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 232≤1 km 69≤10 km 32>10 km 48

381 georeferenced · 85 without coordinates

Open the mapobservation + sensor466

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 5≤1 km 44≤10 km 97>10 km 13

159 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	46
New Haven, US	45
King Saud Universitylocation not on record	31
East Lansing, US	30
ASUlocation not on record	11
North Carolina State University Insect Museumlocation not on record	9
Georgia Museum of Natural Historylocation not on record	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Royal Saskatchewan Museumlocation not on record	7
CUlocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Colorado State Universitylocation not on record	3
St. Paul, US	3
Toronto, CA	2
University of Central Floridalocation not on record	2
Philadelphia, US	1
University of Alberta Museums (UAM)location not on record	1

17 institutions · 215 of 223 vouchered records shown · 8 without an institution code

09Environmental DNA21 detections

Where the DNA of Acronicta longa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 13.9–21.9

Seasonal swing summer↔winter25.6 °C

Max temp (day)23.4 °C 19.7–27.7

Min temp (night)12.9 °C 10.2–17.5

Precipitation98.3 mm/mo 74.2–140

Air humidity57.4 % 53.6–58.3

Moisture balance-28.3 mm/mo -78.6–-2.70

Vapour deficit892 Pa 713–1,189

Wind speed4.10 m/s 2.40–5.00

Cloud cover39.1 % 31.5–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)