Acronicta noctivaga

Grote, 1864 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records749

Data sources7

Biological traits0

DNA specimens23

eDNA detections23

Sources7 archives

Databases and archives Acronicta noctivaga's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility749 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF749 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Acronicta noctivaga, the night-wandering dagger moth, is a moth of the family Noctuidae. It is found in north-eastern North America (including Wisconsin, New York, Maryland and Ontario). The wingspan is about 32 mm. Adults are on wing from May to August depending on the location. Recorded food plants include poplar.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta noctivaga has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

2Amostly conserved

367Cmostly conserved

433Avariable

445Tmostly conserved

448Cmostly conserved

622Tmostly conserved

625Gvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes5

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta menyanthidissame genus4.1%Acronicta rumicissame genus4.3%Acronicta speratasame genus5.0%Acronicta spineasame genus5.2%Acronicta lupinisame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type749 records

Wild obs. + sensor486

Museum / vouchered263

Range

Area of Occupancy AOO1 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 276≤1 km 77≤10 km 26>10 km 17

396 georeferenced · 90 without coordinates

Open the mapobservation + sensor486

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 4≤1 km 61≤10 km 86>10 km 11

162 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence263

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	73
East Lansing, US	64
Mississippi State, US	36
University of Alberta Museums (UAM)location not on record	25
St. Paul, US	7
North Carolina State University Insect Museumlocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Toronto, CA	5
Washington, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Cornell University Insect Collectionlocation not on record	3
Cambridge, US	2
CUlocation not on record	2
San Francisco, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
UDlocation not on record	2
Saint John, CA	2
Philadelphia, US	1
Denver, US	1
Chicago, US	1

20 institutions · 246 of 263 vouchered records shown · 17 without an institution code

09Environmental DNA23 detections

Where the DNA of Acronicta noctivaga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

Temperate mixed forestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 11.1–19.4

Seasonal swing summer↔winter27.2 °C

Max temp (day)20.0 °C 16.4–23.6

Min temp (night)11.4 °C 5.80–17.1

Precipitation109 mm/mo 86.9–127

Air humidity57.6 % 56.3–63.5

Moisture balance-16.7 mm/mo -58.8–8.80

Vapour deficit733 Pa 566–901

Wind speed3.10 m/s 2.40–5.20

Cloud cover45.2 % 40.7–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)