Acronicta oblinita

J.E.Smith, 1797 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records4 844

Data sources7

Biological traits0

DNA specimens43

eDNA detections43

Sources7 archives

Databases and archives Acronicta oblinita's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 844 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 844 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD43 specimens

01Narrative

Acronicta oblinita, the smeared dagger moth or arioch dagger, is a moth of the family Noctuidae. The species was first described by James Edward Smith in 1797.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta oblinita has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes1

eDNA detections43

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

172Cmostly conserved

241Avariable

250Tvariable

370Gmostly conserved

400Tvariable

478Tvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCCTTAAGATTATTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes13

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta rumicissame genus4.6%Acronicta spineasame genus4.7%Acronicta lupinisame genus4.7%Acronicta menyanthidissame genus5.2%Acronicta noctivagasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 844 records

Wild obs. + sensor4 314

Museum / vouchered530

Range

Area of Occupancy AOO11 872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 2 354≤1 km 655≤10 km 213>10 km 340

3 562 georeferenced · 752 without coordinates

Open the mapobservation + sensor4 314

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 20≤1 km 85≤10 km 186>10 km 14

305 georeferenced · 225 without coordinates

Open the institutions mapphysical evidence530

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	139
New Haven, US	87
University of Alberta Museums (UAM)location not on record	62
Mississippi State, US	42
St. Paul, US	35
Cleveland Museum of Natural History, OH (CLEV)location not on record	33
Colorado State Universitylocation not on record	17
King Saud Universitylocation not on record	13
ASUlocation not on record	11
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Cambridge, US	5
Brussels, BE	5
UDlocation not on record	4
Toronto, CA	4
Chicago, US	3
Philadelphia, US	3
RBINS-Scientific Heritagelocation not on record	2
Natural History Museum of Utahlocation not on record	2
Royal Saskatchewan Museumlocation not on record	2
Washington, US	1
SOVTlocation not on record	1
University of Guelphlocation not on record	1
OSUClocation not on record	1

24 institutions · 493 of 530 vouchered records shown · 37 without an institution code

09Environmental DNA43 detections

Where the DNA of Acronicta oblinita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

BeachMixed HabitatWetlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.3 °C 10.0–24.1

Seasonal swing summer↔winter25.7 °C

Max temp (day)21.6 °C 16.3–26.0

Min temp (night)12.4 °C 5.40–19.9

Precipitation97.8 mm/mo 61.0–113

Air humidity57.2 % 54.5–64.0

Moisture balance-31.5 mm/mo -98.1–-11.0

Vapour deficit794 Pa 554–1,102

Wind speed4.10 m/s 2.60–5.70

Cloud cover40.9 % 32.6–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta oblinita

At a glance

Sources7 archives

At a glance

Record type4 844 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 844 records