Acronicta innotata

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Acronicta

At a glance

Occurrence records2 339

Data sources7

Biological traits0

DNA specimens111

eDNA detections111

Sources7 archives

Databases and archives Acronicta innotata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI111 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics111 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 339 records

Environmental DNA1 datasets · 2 countries111 detections

DNA & barcodingBOLD111 specimens

01Narrative

Acronicta innotata, the unmarked dagger moth or birch dagger, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852. It is found from Newfoundland to British Columbia and adjacent northern states in the United States, south in the east to North Carolina and Kentucky. The wingspan is 35–40 mm. Adults are on wing from May to August depending on the location. The larvae feed on the leaves of alder, birch, cherry, hickory, poplar and willow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding111 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acronicta innotata has left across the world's sequence archives.

At a glance

DNA specimens111

BINs1

Marker genes1

eDNA detections111

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus109 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

263Cmostly conserved

277Cmostly conserved

448Tmostly conserved

496Amostly conserved

520Amostly conserved

536Tmostly conserved

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes11

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acronicta betulaesame genus3.6%Acronicta spinigerasame genus3.8%Acronicta hastasame genus4.4%Acronicta radcliffeisame genus4.9%Acronicta rapidansame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 339 records

Wild obs. + sensor1 803

Museum / vouchered536

Range

Area of Occupancy AOO4 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 152≤1 km 217≤10 km 64>10 km 75

1 508 georeferenced · 295 without coordinates

Open the mapobservation + sensor1 803

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 6≤1 km 57≤10 km 144>10 km 8

215 georeferenced · 321 without coordinates

Open the institutions mapphysical evidence536

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	91
University of Alberta Museums (UAM)location not on record	77
East Lansing, US	74
University of Guelph, Centre for Biodiversity Genomicslocation not on record	59
Royal Saskatchewan Museumlocation not on record	18
St. Paul, US	17
Colorado State Universitylocation not on record	15
Cambridge, US	12
North Carolina State University Insect Museumlocation not on record	12
Mississippi State, US	9
Brussels, BE	9
Cornell University Insect Collectionlocation not on record	6
Toronto, CA	6
Oregon State Arthropod Collectionlocation not on record	6
RBINS-Scientific Heritagelocation not on record	6
Vernal, US	4
WWUlocation not on record	3
University of Guelphlocation not on record	2
OSUClocation not on record	2
San Francisco, US	1
Chicago, US	1
Washington, US	1
SOVTlocation not on record	1

23 institutions · 432 of 536 vouchered records shown · 104 without an institution code

09Environmental DNA111 detections

Where the DNA of Acronicta innotata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found111

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 111 detections have coordinates

Open the map2 countries0

Temperate mixed forestMixed HabitatGrasslandBeachForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 13.5–19.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.2 °C 16.4–25.6

Min temp (night)13.4 °C 7.60–16.4

Precipitation89.3 mm/mo 68.6–138

Air humidity62.5 % 54.0–64.4

Moisture balance-42.2 mm/mo -70.6–14.7

Vapour deficit824 Pa 572–1,016

Wind speed3.30 m/s 1.80–3.90

Cloud cover48.1 % 33.0–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 106 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acronicta innotata

At a glance

Sources7 archives

At a glance

Record type2 339 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 339 records