Acrolophus popeanella

Clemens, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records10 913

Data sources7

Biological traits0

DNA specimens167

eDNA detections156

Sources7 archives

Databases and archives Acrolophus popeanella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 913 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI156 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics167 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 913 records

Environmental DNA1 datasets · 1 countries156 detections

DNA & barcodingBOLD167 specimens

01Narrative

Acrolophus popeanella (Clemens' grass tubeworm moth) is a moth of the family Acrolophidae. It is found in the eastern United States, from New Jersey and Ohio south to Florida and west to Illinois, Nebraska and Texas. The wingspan is 24–33 mm. The forewings are yellowish to reddish brown or purplish and heavily marked with darker colors. Adults are on wing from May to September. The larvae feed on the roots of Trifolium pratense.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding167 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus popeanella has left across the world's sequence archives.

At a glance

DNA specimens167

BINs10

Marker genes2

eDNA detections156

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus159 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

34Cvariable

38Tvariable

52Avariable

74Cmostly conserved

80Avariable

81Avariable

88Avariable

100Avariable

106Tmostly conserved

115Tvariable

118Tmostly conserved

130Tvariable

166Amostly conserved

199Amostly conserved

212Cmostly conserved

214Amostly conserved

262Amostly conserved

263Cvariable

268Amostly conserved

271Cmostly conserved

274Avariable

322Gmostly conserved

346Cvariable

347Tmostly conserved

367Tmostly conserved

376Avariable

379Amostly conserved

385Tvariable

403Amostly conserved

406Tvariable

439Amostly conserved

469Gvariable

470Amostly conserved

472Cmostly conserved

478Avariable

490Tvariable

493Amostly conserved

496Amostly conserved

508Cvariable

523Tvariable

565Avariable

571Cvariable

580Avariable

616Cmostly conserved

619Amostly conserved

622Cmostly conserved

625Avariable

634Cvariable

637Tvariable

AACATTATATTTTATTTTTGGTATTTGATCAGGCATATTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAACTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 44 variants.

Diversity (π)2.8%

Haplotypes44

BINs10

Most divergent pair9.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus propinquasame genus6.4%Acrolophus morasame genus8.2%Acrolophus hasbrouckisame genus8.5%Acrolophus forbesisame genus8.7%Acrolophus macrophallussame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type10 913 records

Wild obs. + sensor10 328

Museum / vouchered585

Range

Area of Occupancy AOO16 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 5 393≤1 km 1 170≤10 km 403>10 km 1 478

8 444 georeferenced · 1 884 without coordinates

Open the mapobservation + sensor10 328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 9≤1 km 23≤10 km 200>10 km 74

306 georeferenced · 279 without coordinates

Open the institutions mapphysical evidence585

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	281
East Lansing, US	54
ASUlocation not on record	36
Georgia Museum of Natural Historylocation not on record	34
King Saud Universitylocation not on record	22
Washington, US	21
Cornell University Insect Collectionlocation not on record	21
New Haven, US	19
CUlocation not on record	19
St. Paul, US	19
US	17
Denver, US	11
Cambridge, US	8
Vernal, US	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Philadelphia, US	2
Natural History Museum of Utahlocation not on record	2
Colorado State Universitylocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

21 institutions · 583 of 585 vouchered records shown · 2 without an institution code

09Environmental DNA156 detections

Where the DNA of Acrolophus popeanella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found156

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 156 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 25.2–28.0

Seasonal swing summer↔winter23.3 °C

Max temp (day)31.8 °C 27.7–33.0

Min temp (night)23.0 °C 21.2–24.2

Precipitation119 mm/mo 74.3–238

Air humidity60.8 % 55.2–62.5

Moisture balance-50.0 mm/mo -127–73.2

Vapour deficit1,371 Pa 1,251–1,696

Wind speed3.80 m/s 1.90–4.00

Cloud cover30.7 % 27.3–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 148 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus popeanella

At a glance

Sources7 archives

At a glance

Record type10 913 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 913 records