Acrolophus mora

Grote, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records1 069

Data sources7

Biological traits0

DNA specimens33

eDNA detections36

Sources7 archives

Databases and archives Acrolophus mora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 069 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 069 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD33 specimens

01Narrative

Acrolophus mora, the dark acrolophus, is a moth of the family Acrolophidae. It was described by Augustus Radcliffe Grote in 1881. It is found in North America, including Florida, Georgia, Illinois, Kentucky, Maryland, Massachusetts, Mississippi, New Hampshire, New York, North Carolina, Ohio, Quebec, South Carolina, Tennessee, Virginia and West Virginia. The wingspan is about 20 mm for males and 26 mm for females.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus mora has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

49Tmostly conserved

79Amostly conserved

82Tmostly conserved

88Gmostly conserved

229Gmostly conserved

361Tmostly conserved

401Cmostly conserved

433Amostly conserved

517Amostly conserved

571Cmostly conserved

628Gmostly conserved

AACATTATATTTTATTTTCGGTATCTGATCAGGAATAGTAGGAACATCTTTAAGATTACTAATTCGTGCTGAATTAGGAAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes6

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus hasbrouckisame genus8.2%Acrolophus popeanellasame genus8.2%Acrolophus forbesisame genus9.1%Acrolophus variabilissame genus9.1%Acrolophus melanodoxasame genus9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 069 records

Wild obs. + sensor937

Museum / vouchered132

Range

Area of Occupancy AOO2 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 504≤1 km 138≤10 km 70>10 km 90

802 georeferenced · 135 without coordinates

Open the mapobservation + sensor937

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤1 km 43≤10 km 25>10 km 1

69 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cornell University Insect Collectionlocation not on record	42
East Lansing, US	27
New Haven, US	23
St. Paul, US	6
CUlocation not on record	5
Philadelphia, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Cambridge, US	2
ASUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Decorah, US	1
SOVTlocation not on record	1

12 institutions · 117 of 132 vouchered records shown · 15 without an institution code

09Environmental DNA36 detections

Where the DNA of Acrolophus mora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 8.10–18.0

Seasonal swing summer↔winter28.4 °C

Max temp (day)19.8 °C 12.6–21.8

Min temp (night)11.4 °C 4.90–16.2

Precipitation99.9 mm/mo 92.2–143

Air humidity59.2 % 58.6–64.4

Moisture balance9.00 mm/mo -3.40–45.5

Vapour deficit703 Pa 445–813

Wind speed3.50 m/s 2.40–4.00

Cloud cover53.6 % 37.8–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acrolophus mora

At a glance

Sources7 archives

At a glance

Record type1 069 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 069 records