Acrolophus propinqua

Walsingham, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Acrolophus

At a glance

Occurrence records635

Data sources7

Biological traits0

DNA specimens36

eDNA detections34

Sources7 archives

Databases and archives Acrolophus propinqua's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility635 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF635 records

Environmental DNA1 datasets · 1 countries34 detections

DNA & barcodingBOLD36 specimens

01Narrative

Acrolophus propinqua (Walsingham's grass tubeworm moth) is a moth of the family Acrolophidae. It is found in North America, including Alabama, Florida, Georgia, Illinois, Louisiana, Maryland, Mississippi, North Carolina, New York, Ohio, South Carolina, Tennessee, Virginia and West Virginia.mothphotographersgroup The wingspan is 22–26 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acrolophus propinqua has left across the world's sequence archives.

At a glance

DNA specimens36

BINs11

Marker genes1

eDNA detections34

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 91 variable positions, in barcode order

5Tmostly conserved

10Tmostly conserved

19Tmostly conserved

34Tmostly conserved

43Avariable

49Tmostly conserved

50Cvariable

56Cmostly conserved

58Amostly conserved

67Amostly conserved

70Cvariable

74Tmostly conserved

82Cvariable

97Tmostly conserved

103Tmostly conserved

106Tvariable

124Tmostly conserved

133Cmostly conserved

136Cvariable

145Tmostly conserved

157Tvariable

166Amostly conserved

187Tmostly conserved

193Tmostly conserved

197Tmostly conserved

199Gvariable

200Gmostly conserved

202Tmostly conserved

211Amostly conserved

217Avariable

220Cvariable

235Cmostly conserved

259Tmostly conserved

263Cmostly conserved

290Amostly conserved

307Tmostly conserved

322Amostly conserved

328Amostly conserved

334Tvariable

340Cmostly conserved

346Tmostly conserved

355Tmostly conserved

358Cvariable

361Tvariable

364Cvariable

367Cmostly conserved

368Gmostly conserved

373Amostly conserved

374Gmostly conserved

376Avariable

385Tmostly conserved

397Cmostly conserved

403Amostly conserved

409Amostly conserved

415Amostly conserved

418Tmostly conserved

421Cmostly conserved

424Amostly conserved

433Amostly conserved

445Tvariable

460Tmostly conserved

470Gmostly conserved

472Cvariable

475Tvariable

478Avariable

481Gvariable

490Cmostly conserved

499Tvariable

505Tmostly conserved

514Cmostly conserved

529Tmostly conserved

535Tmostly conserved

541Amostly conserved

544Cvariable

547Avariable

548Tmostly conserved

550Avariable

556Cmostly conserved

578Tmostly conserved

583Amostly conserved

589Tmostly conserved

595Tvariable

601Tmostly conserved

604Tmostly conserved

613Cmostly conserved

616Cmostly conserved

625Amostly conserved

628Amostly conserved

637Tvariable

643Tvariable

646Tvariable

AACATTATATTTTATTTTTGGTATTTGATCAGGTATACTAGGAACTTCTCTAAGACTATTAATTCGAGCCGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.4%

Haplotypes21

BINs11

Most divergent pair9.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acrolophus popeanellasame genus6.4%Acrolophus melanodoxasame genus8.7%Acrolophus forbesisame genus9.0%Acrolophus macrophallussame genus9.0%Acrolophus hasbrouckisame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type635 records

Wild obs. + sensor497

Museum / vouchered138

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 219≤1 km 85≤10 km 20>10 km 49

373 georeferenced · 124 without coordinates

Open the mapobservation + sensor497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 9≤1 km 9≤10 km 34>10 km 6

58 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	51
Cornell University Insect Collectionlocation not on record	27
New Haven, US	16
Georgia Museum of Natural Historylocation not on record	12
Denver, US	9
CUlocation not on record	8
Washington, US	8
ASUlocation not on record	4
East Lansing, US	2
Cambridge, US	1

10 institutions · 138 of 138 vouchered records shown

09Environmental DNA34 detections

Where the DNA of Acrolophus propinqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 22.9–26.1

Seasonal swing summer↔winter23.4 °C

Max temp (day)29.4 °C 27.6–31.4

Min temp (night)19.8 °C 18.1–22.2

Precipitation105 mm/mo 88.2–182

Air humidity57.8 % 56.2–61.5

Moisture balance-58.8 mm/mo -96.3–21.0

Vapour deficit1,283 Pa 1,124–1,395

Wind speed2.90 m/s 2.20–3.80

Cloud cover33.8 % 29.6–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)