Acossus terebra

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Cossidae/Acossus

At a glance

Occurrence records964

Data sources7

Biological traits0

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Acossus terebra's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility964 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF964 records

Environmental DNA1 datasets · 4 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acossus terebra is a species of moth of the family Cossidae. It is found in Eurasia, including Israel, Turkey, northern Spain, central and southern Europe, southern Sweden, Finland, the Baltic region, Ukraine, the central part of European Russia, the Caucasus, southern Siberia (including the Altai and Sayan Mountains) to southern Yakutia, the southern part of the Russian Far East, Korea, Heilongjiang, Jilin and inner Mongolia.Taxonomic notes on Acossus Dyar and Parahypopta Daniel (Cossidae) The wingspan is 55–64 mm. Adults are on wing from June to August. The larvae feed on Populus tremula.Moths and Butterflies of Europe and North Africa

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acossus terebra has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

160Avariable

220Cmostly conserved

374Amostly conserved

550Gmostly conserved

578Tmostly conserved

622Gmostly conserved

AACACTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes4

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acossus populisame genus5.3%Prionoxystus macmurtreisame family7.0%Acossus centerensissame genus7.1%Prionoxystus pigersame family7.6%Prionoxystus robiniaesame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type964 records

Wild obs. + sensor806

Museum / vouchered158

Range

Area of Occupancy AOO2 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 502≤1 km 139≤10 km 87>10 km 11

739 georeferenced · 67 without coordinates

Open the mapobservation + sensor806

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 72≤1 km 34≤10 km 22>10 km 2

130 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	45
Tartu, EE	24
NHMOlocation not on record	17
SLU Artdatabankenlocation not on record	14
Uniwersytet Łódzkilocation not on record	9
Helsinki, FI	6
Philadelphia, US	4
Metsähallituslocation not on record	2
DABUHlocation not on record	2
ZMAAlocation not on record	2
NTNU-VMlocation not on record	1
Rovaniemi, FI	1
JLGTlocation not on record	1
VLHFlocation not on record	1

14 institutions · 129 of 158 vouchered records shown · 29 without an institution code

09Environmental DNA8 detections

Where the DNA of Acossus terebra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 4.60–18.3

Seasonal swing summer↔winter16.6 °C

Max temp (day)20.2 °C 8.10–22.4

Min temp (night)11.6 °C 0.8–13.6

Precipitation58.8 mm/mo 52.4–106

Air humidity55.8 % 52.1–62.1

Moisture balance-63.7 mm/mo -113–-1.50

Vapour deficit810 Pa 377–948

Wind speed2.50 m/s 2.00–3.80

Cloud cover33.7 % 29.1–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)