Acossus populi

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Cossidae/Acossus

At a glance

Occurrence records565

Data sources7

Biological traits0

DNA specimens39

eDNA detections36

Sources7 archives

Databases and archives Acossus populi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility565 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF565 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD39 specimens

01Narrative

Acossus populi, the aspen carpenterworm, is a moth of the family Cossidae. It is found in the United States in Nevada, Colorado, California and in the northern Rocky Mountains. In Canada it is found in Ontario and British Columbia. The wingspan is 50–68 mm. The larvae feed on Populus species, mainly Populus tremuloides.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acossus populi has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes1

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

31Tmostly conserved

38Gvariable

82Tmostly conserved

88Gvariable

100Gmostly conserved

118Tmostly conserved

144Tmostly conserved

157Cmostly conserved

178Tmostly conserved

223Cmostly conserved

235Cmostly conserved

298Avariable

317Gmostly conserved

337Tmostly conserved

343Cmostly conserved

364Tmostly conserved

367Tmostly conserved

370Amostly conserved

418Tmostly conserved

436Tmostly conserved

449Avariable

472Tmostly conserved

478Cmostly conserved

506Amostly conserved

527Amostly conserved

538Amostly conserved

550Tmostly conserved

554Gmostly conserved

601Tmostly conserved

622Amostly conserved

AACACTATATTTTATTTTCGGTATTTGATCTGGAATAGTAGGAACTTCTCTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes15

BINs2

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acossus terebrasame genus5.3%Acossus centerensissame genus6.5%Prionoxystus pigersame family8.1%Prionoxystus macmurtreisame family8.7%Prionoxystus robiniaesame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type565 records

Wild obs. + sensor366

Museum / vouchered199

Range

Area of Occupancy AOO936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 219≤1 km 31≤10 km 10>10 km 15

275 georeferenced · 91 without coordinates

Open the mapobservation + sensor366

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 33≤1 km 5≤10 km 49>10 km 3

90 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	54
University of Alberta Museums (UAM)location not on record	43
Colorado State Universitylocation not on record	35
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Vernal, US	9
Mississippi State, US	5
Washington, US	5
Royal Saskatchewan Museumlocation not on record	5
ASUlocation not on record	3
East Lansing, US	2

10 institutions · 179 of 199 vouchered records shown · 20 without an institution code

09Environmental DNA36 detections

Where the DNA of Acossus populi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

ForestGrasslandMixed HabitatUV lightRiparian ZoneD.fir slope, UV light

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 9.90–18.4

Seasonal swing summer↔winter23.2 °C

Max temp (day)23.2 °C 16.1–25.4

Min temp (night)10.9 °C 4.00–11.9

Precipitation73.2 mm/mo 14.5–110

Air humidity52.8 % 45.7–56.9

Moisture balance-82.7 mm/mo -119–-7.60

Vapour deficit903 Pa 533–1,097

Wind speed1.90 m/s 1.30–2.60

Cloud cover34.3 % 14.9–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)