Acossus centerensis

Lintner, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Cossidae/Acossus

At a glance

Occurrence records617

Data sources7

Biological traits0

DNA specimens21

eDNA detections28

Sources7 archives

Databases and archives Acossus centerensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility617 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF617 records

Environmental DNA1 datasets · 1 countries28 detections

DNA & barcodingBOLD21 specimens

01Narrative

Acossus centerensis, the poplar carpenterworm, is a moth of the family Cossidae. It is found in North America from New Jersey west to Illinois and North Dakota. In Canada it is found from Quebec and Ontario west to British Columbia. The wingspan is 40–50 mm for males and 50–64 mm for females. The larvae feed on Populus species, mainly Populus tremuloides, but also balsam poplars.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acossus centerensis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

40Gmostly conserved

50Cmostly conserved

68Amostly conserved

82Cmostly conserved

91Tmostly conserved

100Gmostly conserved

160Amostly conserved

181Amostly conserved

202Gmostly conserved

220Cmostly conserved

241Gmostly conserved

263Tmostly conserved

278Tmostly conserved

305Amostly conserved

322Cmostly conserved

340Tmostly conserved

355Tmostly conserved

362Tmostly conserved

373Amostly conserved

389Amostly conserved

391Gmostly conserved

538Tmostly conserved

541Gmostly conserved

548Tmostly conserved

550Amostly conserved

553Cmostly conserved

610Tmostly conserved

619Tmostly conserved

625Amostly conserved

628Amostly conserved

631Amostly conserved

637Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGATCTGGAATAGTGGGAACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.97%

Haplotypes3

BINs2

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acossus populisame genus6.5%Acossus terebrasame genus7.1%Prionoxystus pigersame family8.4%Prionoxystus robiniaesame family8.7%Prionoxystus macmurtreisame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type617 records

Wild obs. + sensor459

Museum / vouchered158

Range

Area of Occupancy AOO1 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 310≤1 km 62≤10 km 10>10 km 21

403 georeferenced · 56 without coordinates

Open the mapobservation + sensor459

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 2≤1 km 26≤10 km 55>10 km 4

87 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	57
New Haven, US	25
University of Alberta Museums (UAM)location not on record	22
Royal Saskatchewan Museumlocation not on record	22
Cornell University Insect Collectionlocation not on record	8
Washington, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Cambridge, US	2
Colorado State Universitylocation not on record	2
Georgia Museum of Natural Historylocation not on record	2
Vernal, US	1
University of Guelphlocation not on record	1
University of California, Davislocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

14 institutions · 152 of 158 vouchered records shown · 6 without an institution code

09Environmental DNA28 detections

Where the DNA of Acossus centerensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map1 country0

UV Light, dry woods/barrensSand dune parklandSite #127Unitrap with pheromone from Pherobank (E,E)-…UVLUV light, oak/hickory

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 8.80–19.9

Seasonal swing summer↔winter30.3 °C

Max temp (day)23.5 °C 14.3–25.6

Min temp (night)13.4 °C 4.00–15.8

Precipitation81.6 mm/mo 75.0–106

Air humidity57.8 % 55.2–59.2

Moisture balance-59.3 mm/mo -66.3–-16.6

Vapour deficit879 Pa 513–987

Wind speed3.30 m/s 2.80–4.00

Cloud cover43.2 % 38.6–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)