Acmaeoderella villosula

(Steven, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeoderella

At a glance

Occurrence records135

Data sources5

Biological traits0

DNA specimens6

eDNA detections0

Sources5 archives

Databases and archives Acmaeoderella villosula's data was compiled from.

GBIFGlobal Biodiversity Information Facility135 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF135 records

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeoderella villosula has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.53%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 7 variable positions, in barcode order

203Tmostly conserved

275Tmostly conserved

284Cmostly conserved

407Cmostly conserved

425Cmostly conserved

527Tmostly conserved

542Tmostly conserved

GCACCCTTTATTTTATCTTTGGTGCATGATCAGGCATAATTGGAACCGCTCTAAGACTTTTAATTCGATCAGAACTAGGTAACCCTGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Astraeus elongatussame family16.1%Lamprodila festivasame family16.9%Creophilus maxillosussame order17.8%Fleutiauxellus extricatussame order17.9%Agrilus roscidussame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type135 records

Wild obs. + sensor62

Museum / vouchered73

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 32≤1 km 17≤10 km 3

52 georeferenced · 10 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 3≤10 km 2

5 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muzeum Górnośląskie w Bytomiulocation not on record	53
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	12
MZLUlocation not on record	5
Ilia State Universitylocation not on record	2
Philadelphia, US	1

5 institutions · 73 of 73 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)