Lamprodila festiva

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Lamprodila

At a glance

Occurrence records1 431

Data sources8

Biological traits0

DNA specimens9

eDNA detections1

Sources8 archives

Databases and archives Lamprodila festiva's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 431 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

Lamprodila festiva is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lamprodila festiva has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes1

BINs2

Where individuals differ — all 29 variable positions, in barcode order

34Cmostly conserved

58Gmostly conserved

157Cmostly conserved

163Tvariable

166Amostly conserved

235Cmostly conserved

250Cmostly conserved

277Gmostly conserved

289Gmostly conserved

305Gmostly conserved

328Amostly conserved

340Cmostly conserved

343Cmostly conserved

346Amostly conserved

358Tmostly conserved

367Tmostly conserved

370Cvariable

373Gvariable

391Cmostly conserved

421Cmostly conserved

433Cvariable

448Cmostly conserved

541Tmostly conserved

542Cmostly conserved

553Tmostly conserved

616Cvariable

631Amostly conserved

634Cmostly conserved

646Cmostly conserved

AACCCTTTACTTTATTTTTGGAGCTTGATCTGGCATAGTTGGAACAGCTCTTAGATTGCTAATCCGAGCCGAACTAGGAAATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Merimna atratasame family14.9%Ontholestes tessellatussame order15.3%Perotis susannaesame family15.8%Ontholestes cingulatussame order16.0%Eretes sticticussame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 431 records

Wild obs. + sensor1 189

Museum / vouchered234

Other8

Origin

Native282

Range

Area of Occupancy AOO3 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 347≤1 km 111≤10 km 482>10 km 21

961 georeferenced · 228 without coordinates

Open the mapobservation + sensor1 189

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 209>10 km 14

223 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	33
Bern, CH	24
Musee d'Histoire Naturallelocation not on record	20
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	11
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
Zürich, CH	4
Mykotektet, National Veterinary Institutelocation not on record	4
Paro, BT	2
Paris, FR	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Provincia di Livornolocation not on record	1
INCONNUlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

13 institutions · 110 of 234 vouchered records shown · 124 without an institution code

09Environmental DNA1 detections

Where the DNA of Lamprodila festiva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 18.5–18.5

Seasonal swing summer↔winter19.4 °C

Max temp (day)23.0 °C

Min temp (night)13.1 °C

Precipitation82.9 mm/mo

Air humidity57.7 %

Moisture balance-55.2 mm/mo

Vapour deficit906 Pa

Wind speed2.40 m/s

Cloud cover32.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lamprodila festiva

At a glance

Sources8 archives

At a glance

Record type1 431 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 431 records