Eretes sticticus

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dytiscidae/Eretes

At a glance

Occurrence records638

Data sources7

Biological traits0

DNA specimens28

eDNA detections34

Sources7 archives

Databases and archives Eretes sticticus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF638 records

Environmental DNA1 datasets · 7 countries34 detections

DNA & barcodingBOLD28 specimens

Genome at a glanceGoaT2n = 44

01Narrative

Eretes sticticus, the western erete, is a species of predaceous diving beetle in the family Dytiscidae. It is found in Africa, the Middle East, and the Americas from the southern United States to Peru.Miller, K. B. (2002). Revision of the genus Eretes Laporte, 1833 (Coleoptera: Dytiscidae). Aquatic Insects, 24(4), 247-272.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eretes sticticus has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes3

eDNA detections34

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

16Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

24Cmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Amostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

181Gmostly conserved

184Avariable

211Amostly conserved

319Amostly conserved

415Amostly conserved

433Gvariable

517Amostly conserved

628Gmostly conserved

652Tmostly conserved

653Cmostly conserved

AACATTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTTGGAACATCTTTAAGTATATTAATTCGAGCCGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes10

BINs2

Most divergent pair6.1%

AsiaAfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hydaticus seminigersame family9.6%Olisthopus parmatussame order10.0%Agonum mutatumsame order10.3%Graphoderus perplexussame family10.5%Plochionus timidussame order10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_054235 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnSrrnL

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Eretes sticticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 431×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 441×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type638 records

Wild obs. + sensor172

Museum / vouchered463

Other3

Range

Area of Occupancy AOO1 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 15≤1 km 12≤10 km 64

91 georeferenced · 81 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 16≤1 km 4≤10 km 141>10 km 13

174 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence463

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	121
NSMKlocation not on record	56
Chicago, US	47
Wuzhou, CN	47
National Museums of Kenyalocation not on record	38
Chiba, JP	38
Cape Town, ZA	33
Sam Noble Oklahoma Museum of Natural Historylocation not on record	13
Santa Barbara Museum of Natural Historylocation not on record	7
Sydney, AU	6
Sagamihara, JP	6
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	5
Mangilao, GU	4
South Kensington, GB	3
KCMNlocation not on record	3
Tomioka, JP	3
Yamaguchi-shi, JP	1
UVEG-ENVlocation not on record	1
ASUlocation not on record	1
Philadelphia, US	1
UAclocation not on record	1
Natural History Museum of Utahlocation not on record	1
Awka, NG	1
KOMlocation not on record	1
Helsinki, FI	1
Albuquerque, US	1
Tokushima, JP	1
ERWClocation not on record	1

28 institutions · 442 of 463 vouchered records shown · 18 without an institution code

09Environmental DNA34 detections

Where the DNA of Eretes sticticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map7 countries0

River

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 16.0–34.0

Seasonal swing summer↔winter20.2 °C

Max temp (day)28.8 °C 21.7–39.6

Min temp (night)23.0 °C 11.2–27.7

Precipitation112 mm/mo 43.0–308

Air humidity61.9 % 47.9–66.7

Moisture balance-42.4 mm/mo -158–150

Vapour deficit1,175 Pa 796–2,773

Wind speed2.40 m/s 1.40–3.80

Cloud cover22.8 % 11.1–47.7

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)