Acmaeodera rubronotata

Laporte & Gory, 1835 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records1 618

Data sources8

Biological traits0

DNA specimens10

eDNA detections9

Sources8 archives

Databases and archives Acmaeodera rubronotata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 618 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 618 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acmaeodera rubronotata is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera rubronotata has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

34Gmostly conserved

43Amostly conserved

121Cmostly conserved

178Avariable

373Cmostly conserved

403Cvariable

655Avariable

AACACTTTACTTCATCTTCGGAGCATGATCGGGGATAGTAGGAACAGCCCTAAGACTGCTAATCCGAGCCGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes4

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acmaeodera paravilipissame genus15.2%Acmaeodera bipunctatasame genus15.6%Acmaeodera idahoensissame genus15.7%Acmaeodera scalarissame genus16.3%Acmaeodera pulchellasame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 618 records

Wild obs. + sensor607

Museum / vouchered1 011

Range

Area of Occupancy AOO1 956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 305≤1 km 128≤10 km 26>10 km 23

482 georeferenced · 125 without coordinates

Open the mapobservation + sensor607

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 5≤1 km 195≤10 km 624>10 km 118

942 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence1 011

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	512
ASUlocation not on record	258
US	86
Universidad Católica de Manizaleslocation not on record	41
Lubbock, US	33
College Station, US	15
WIlocation not on record	14
Lexington, US	10
OSUClocation not on record	8
Albany, US	8
Natural History Museum of Utahlocation not on record	5
Chicago, US	4
Denver, US	4
München, DE	4
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	3
Vernal, US	1
MLRClocation not on record	1
Albuquerque, US	1
Colorado State Universitylocation not on record	1
Lake Placid, US	1
University of Arizona, Insect Collectionlocation not on record	1

21 institutions · 1 011 of 1 011 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Acmaeodera rubronotata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 11.9–11.9

Seasonal swing summer↔winter20.2 °C

Max temp (day)18.2 °C

Min temp (night)5.80 °C

Precipitation55.4 mm/mo

Air humidity51.4 %

Moisture balance-81.0 mm/mo

Vapour deficit675 Pa

Wind speed4.30 m/s

Cloud cover15.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acmaeodera rubronotata

At a glance

Sources8 archives

At a glance

Record type1 618 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 618 records