Acmaeodera bipunctata

(Olivier, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records699

Data sources7

Biological traits0

DNA specimens6

eDNA detections0

Sources7 archives

Databases and archives Acmaeodera bipunctata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility699 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF699 records

DNA & barcodingBOLD6 specimens

01Narrative

Acmaeodera bipunctata ist ein Käfer aus der Familie der Prachtkäfer und der Unterfamilie Polycestinae. Die Gattung Acmaeodera ist in Europa mit 25 Arten vertreten, die in drei Untergattungen eingeteilt werden. Acmaeodera bipunctata wird zur Untergattung Palaeotethya gerechnet, die in Europa mit vier Arten vertreten ist. Die Art Acmaeodera bipunctata kommt in Europa in sechs Unterarten vor.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera bipunctata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BINs2

Most divergent pair4.1%

Where individuals differ — all 27 variable positions, in barcode order

2Tmostly conserved

50Tmostly conserved

83Amostly conserved

110Cmostly conserved

167Tmostly conserved

170Cmostly conserved

179Tmostly conserved

275Cmostly conserved

278Cmostly conserved

282Cmostly conserved

284Amostly conserved

290Amostly conserved

353Tmostly conserved

405Cmostly conserved

407Gmostly conserved

434Gmostly conserved

440Tmostly conserved

443Cmostly conserved

488Tmostly conserved

515Gmostly conserved

527Tmostly conserved

540Tmostly conserved

560Cmostly conserved

575Amostly conserved

587Tmostly conserved

599Tmostly conserved

629Tmostly conserved

CTCTTTACTTTATTTTCGGTGCCTGATCAGGAATAGTAGGAACAGCTCTTAGACTATTAATTCGAGCTGAACTTGGAAACCCAGGATCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acmaeodera saxicolasame genus12.8%Acmaeodera rubronotatasame genus15.6%Hemipharis insularissame order15.7%Acmaeoderella adspersulasame family16.4%Tarpela venustasame order16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type699 records

Wild obs. + sensor616

Museum / vouchered43

Other40

Origin

Native134

Range

Area of Occupancy AOO1 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 67≤1 km 172≤10 km 242>10 km 6

487 georeferenced · 129 without coordinates

Open the mapobservation + sensor616

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 4≤1 km 9≤10 km 12

25 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	10
South Kensington, GB	7
IMEDEAlocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
MZLUlocation not on record	5
Albany, US	1
Helsinki, FI	1
Radicondoli, IT	1

8 institutions · 37 of 43 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)