Acmaeodera idahoensis

Barr, 1969 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records340

Data sources8

Biological traits0

DNA specimens7

eDNA detections6

Sources8 archives

Databases and archives Acmaeodera idahoensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF340 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acmaeodera idahoensis is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera idahoensis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 98 variable positions, in barcode order

1Cmostly conserved

4Gmostly conserved

13Cmostly conserved

28Amostly conserved

50Cmostly conserved

58Amostly conserved

73Amostly conserved

82Tmostly conserved

91Amostly conserved

103Tmostly conserved

112Cmostly conserved

115Tmostly conserved

127Cmostly conserved

133Tmostly conserved

145Tmostly conserved

157Cmostly conserved

166Amostly conserved

169Tmostly conserved

170Gmostly conserved

178Amostly conserved

184Tmostly conserved

187Cmostly conserved

190Gmostly conserved

211Amostly conserved

217Amostly conserved

220Cmostly conserved

223Tmostly conserved

226Tmostly conserved

247Cmostly conserved

250Tmostly conserved

253Amostly conserved

262Amostly conserved

268Amostly conserved

277Gmostly conserved

280Tmostly conserved

283Tmostly conserved

287Tmostly conserved

292Amostly conserved

294Cmostly conserved

307Gmostly conserved

316Amostly conserved

322Amostly conserved

325Amostly conserved

328Cmostly conserved

334Tmostly conserved

337Cmostly conserved

343Cmostly conserved

352Tmostly conserved

355Tmostly conserved

364Cmostly conserved

368Amostly conserved

369Gmostly conserved

373Gmostly conserved

376Tmostly conserved

379Tmostly conserved

385Tmostly conserved

386Cmostly conserved

388Tmostly conserved

394Cmostly conserved

400Amostly conserved

401Tmostly conserved

412Amostly conserved

415Tvariable

427Cmostly conserved

436Tmostly conserved

457Tmostly conserved

466Amostly conserved

472Cmostly conserved

482Tmostly conserved

493Amostly conserved

499Cmostly conserved

500Cmostly conserved

514Cmostly conserved

517Amostly conserved

523Cmostly conserved

526Cmostly conserved

535Tmostly conserved

538Cvariable

544Tmostly conserved

565Amostly conserved

571Cvariable

574Gmostly conserved

577Amostly conserved

580Amostly conserved

583Gmostly conserved

586Cmostly conserved

589Cvariable

595Tmostly conserved

598Amostly conserved

601Cmostly conserved

604Amostly conserved

619Amostly conserved

628Amostly conserved

637Cmostly conserved

640Cmostly conserved

643Amostly conserved

646Tmostly conserved

653Cmostly conserved

CACGCTTTACTTCATCTTCGGAGCATGATCCGGAATAGTAGGAACCGCCCTAAGACTACTAATTCGAGCAGAACTTGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.6%

Haplotypes4

BIN1

Most divergent pair14.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acmaeodera flavomarginatasame genus12.8%Acmaeodera opaculasame genus13.8%Acmaeodera decipienssame genus14.1%Acmaeodera connexasame genus14.4%Acmaeodera amabilissame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type340 records

Wild obs. + sensor96

Museum / vouchered244

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 64≤1 km 9≤10 km 4>10 km 1

78 georeferenced · 18 without coordinates

Open the mapobservation + sensor96

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 3≤10 km 12

15 georeferenced · 229 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	208
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	17
University of Alabamalocation not on record	12
ASUlocation not on record	2
University of Central Floridalocation not on record	2
San Francisco, US	1
MLRClocation not on record	1
Albany, US	1

8 institutions · 244 of 244 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Acmaeodera idahoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 9.70–16.6

Seasonal swing summer↔winter22.4 °C

Max temp (day)20.2 °C 15.3–22.2

Min temp (night)6.00 °C 3.20–10.9

Precipitation44.0 mm/mo 38.6–47.0

Air humidity52.2 % 51.5–52.2

Moisture balance-84.8 mm/mo -107–-71.6

Vapour deficit746 Pa 583–914

Wind speed2.10 m/s 1.90–2.80

Cloud cover40.2 % 38.0–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)