Acmaeodera connexa

LeConte, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records762

Data sources8

Biological traits0

DNA specimens9

eDNA detections1

Sources8 archives

Databases and archives Acmaeodera connexa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF762 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acmaeodera connexa is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera connexa has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

1Gvariable

4Amostly conserved

7Tmostly conserved

22Amostly conserved

25Amostly conserved

28Gmostly conserved

31Cmostly conserved

55Amostly conserved

67Amostly conserved

73Gmostly conserved

76Gmostly conserved

85Amostly conserved

109Amostly conserved

112Tmostly conserved

121Tmostly conserved

127Amostly conserved

133Cmostly conserved

142Tmostly conserved

145Cmostly conserved

157Tmostly conserved

166Gmostly conserved

169Cmostly conserved

178Amostly conserved

211Gmostly conserved

217Cmostly conserved

220Tmostly conserved

226Cmostly conserved

229Amostly conserved

250Cmostly conserved

253Gmostly conserved

262Gmostly conserved

268Tmostly conserved

286Tmostly conserved

287Cmostly conserved

289Amostly conserved

301Amostly conserved

302Amostly conserved

313Amostly conserved

319Tmostly conserved

337Tmostly conserved

352Cmostly conserved

361Amostly conserved

373Cmostly conserved

376Cmostly conserved

382Cmostly conserved

385Cmostly conserved

397Tmostly conserved

406Cmostly conserved

412Gmostly conserved

415Amostly conserved

424Amostly conserved

460Tmostly conserved

466Gmostly conserved

472Tmostly conserved

478Gmostly conserved

493Cmostly conserved

499Tmostly conserved

500Tmostly conserved

508Tmostly conserved

517Gmostly conserved

529Tmostly conserved

535Gmostly conserved

538Tmostly conserved

547Cmostly conserved

568Amostly conserved

580Tmostly conserved

581Cmostly conserved

607Tmostly conserved

619Gmostly conserved

628Tmostly conserved

634Cvariable

643Cmostly conserved

653Tmostly conserved

GACACTTTACTTTATCTTCGGAGCATGGTCCGGAATAGTAGGAACCGCCTTAAGACTCCTAATTCGAGCAGAGCTGGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.6%

Haplotypes6

BINs2

Most divergent pair10.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acmaeodera opaculasame genus13.7%Acmaeodera amabilissame genus14.1%Acmaeodera decipienssame genus14.1%Acmaeodera flavomarginatasame genus14.3%Acmaeodera pulchellasame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type762 records

Wild obs. + sensor385

Museum / vouchered377

Range

Area of Occupancy AOO1 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 189≤1 km 49≤10 km 23>10 km 28

289 georeferenced · 96 without coordinates

Open the mapobservation + sensor385

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤1 km 28≤10 km 150>10 km 42

221 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence377

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	137
University of Alabamalocation not on record	92
San Diego, US	48
ASUlocation not on record	40
Natural History Museum of Utahlocation not on record	22
Lexington, US	7
Cambridge, US	6
OSUClocation not on record	5
University of Central Floridalocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	3
Denver, US	3
Albany, US	2
Lubbock, US	2
Universidad Católica de Manizaleslocation not on record	2
MLRClocation not on record	1
College Station, US	1
Saint John, CA	1
University Park, US	1

18 institutions · 377 of 377 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Acmaeodera connexa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)