Acmaeodera decipiens

LeConte, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Acmaeodera

At a glance

Occurrence records1 633

Data sources7

Biological traits0

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Acmaeodera decipiens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 633 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 633 records

DNA & barcodingBOLD4 specimens

01Narrative

Acmaeodera decipiens is a species of metallic wood-boring beetle in the family Buprestidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acmaeodera decipiens has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

4Gmostly conserved

13Tmostly conserved

19Tmostly conserved

43Amostly conserved

61Amostly conserved

64Tmostly conserved

70Gmostly conserved

79Cmostly conserved

91Gmostly conserved

92Cmostly conserved

97Tmostly conserved

109Amostly conserved

112Cmostly conserved

115Tmostly conserved

121Tmostly conserved

127Amostly conserved

133Amostly conserved

145Tmostly conserved

166Amostly conserved

172Tmostly conserved

184Cmostly conserved

187Tmostly conserved

220Cmostly conserved

226Cmostly conserved

250Tmostly conserved

253Gmostly conserved

256Amostly conserved

277Amostly conserved

280Cmostly conserved

283Gmostly conserved

287Tmostly conserved

289Amostly conserved

292Tmostly conserved

304Tmostly conserved

307Tmostly conserved

316Avariable

319Amostly conserved

325Gmostly conserved

328Cmostly conserved

337Cmostly conserved

364Cmostly conserved

373Gmostly conserved

379Cmostly conserved

400Cmostly conserved

403Amostly conserved

406Cmostly conserved

407Cmostly conserved

415Cmostly conserved

421Cmostly conserved

424Tmostly conserved

430Amostly conserved

436Cmostly conserved

439Amostly conserved

451Cmostly conserved

460Tmostly conserved

469Gmostly conserved

472Tmostly conserved

473Gmostly conserved

475Amostly conserved

477Amostly conserved

490Cmostly conserved

500Tmostly conserved

508Amostly conserved

529Tmostly conserved

532Gmostly conserved

535Cmostly conserved

538Amostly conserved

541Cmostly conserved

556Amostly conserved

557Tmostly conserved

559Gmostly conserved

568Avariable

571Tmostly conserved

574Cmostly conserved

578Tmostly conserved

580Gmostly conserved

583Cmostly conserved

586Tmostly conserved

613Tmostly conserved

619Gmostly conserved

625Amostly conserved

631Amostly conserved

640Cvariable

643Amostly conserved

649Amostly conserved

652Tmostly conserved

653Tmostly conserved

658Cmostly conserved

TACGCTTTACTTTATCTTTGGAGCATGATCCGGAATAGTAGGAACCGCCTTAAGACTTCTAATTCGAGCGGAACTTGGCAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.8%

Haplotypes4

BINs2

Most divergent pair13.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acmaeodera flavomarginatasame genus9.1%Acmaeodera opaculasame genus10.2%Acmaeodera pulchellasame genus14.1%Acmaeodera connexasame genus14.1%Acmaeodera idahoensissame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 633 records

Wild obs. + sensor251

Museum / vouchered1 382

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 125≤1 km 47≤10 km 15>10 km 13

200 georeferenced · 51 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 41≤1 km 181≤10 km 939>10 km 195

1 356 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence1 382

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	866
University of Alabamalocation not on record	353
US	97
Universidad Católica de Manizaleslocation not on record	22
College Station, US	11
University Park, US	7
Natural History Museum of Utahlocation not on record	6
OSUClocation not on record	5
Denver, US	4
Mexico City, MX	2
Albany, US	2
Albuquerque, US	1
Wuzhou, CN	1
Cambridge, US	1
Awka, NG	1
Lubbock, US	1
CUlocation not on record	1
Washington, US	1

18 institutions · 1 382 of 1 382 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acmaeodera decipiens

At a glance

Sources7 archives

At a glance

Record type1 633 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Record type1 633 records