Acleris celiana

(Robinson, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Acleris

At a glance

Occurrence records464

Data sources8

Biological traits0

DNA specimens38

eDNA detections38

Sources8 archives

Databases and archives Acleris celiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility464 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF464 records

Environmental DNA1 datasets · 1 countries38 detections

DNA & barcodingBOLD38 specimens

01Narrative

Acleris celiana, Celiana's Acleris, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Alberta, British Columbia, Illinois, Maine, Massachusetts, Michigan, Minnesota, New Brunswick, New Hampshire, North Carolina, North Dakota, Ontario, Quebec, Virginia and Wisconsin.mothphotographersgroup The wingspan is about 18 mm. The forewings are red-brown with an oblique whitish antemedian band, sprinkled with dark dots and with a waved edge.McDunnough, J. 1934. The Canadian species of the Tortricid genus Peronea. Canadian Journal of Research, 1934, 11(3): 290-332 Adults have been recorded on wing from March to November. The larvae feed on Prunus virginiana, Betula (including Betula nana and Betula papyrifera) and Salix species.Tortricidae Food Plant Database

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acleris celiana has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes1

eDNA detections38

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

3Cmostly conserved

4Amostly conserved

9Amostly conserved

14Amostly conserved

40Gmostly conserved

307Gmostly conserved

463Tvariable

553Gmostly conserved

625Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATGGTGGGAACTTCCTTAAGACTATTAATTCGAGCAGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.88%

Haplotypes12

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acleris younganasame genus5.0%Acleris hippophaeanasame genus5.2%Acleris hastianasame genus5.3%Acleris arcticanasame genus5.6%Acleris flavivittanasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type464 records

Wild obs. + sensor364

Museum / vouchered100

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 244≤1 km 30≤10 km 10>10 km 23

307 georeferenced · 57 without coordinates

Open the mapobservation + sensor364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 5≤10 km 13>10 km 1

19 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
New Haven, US	10
St. Paul, US	6
East Lansing, US	4
Cambridge, US	3
Cornell University Insect Collectionlocation not on record	2
Royal Saskatchewan Museumlocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1

9 institutions · 76 of 100 vouchered records shown · 24 without an institution code

09Environmental DNA38 detections

Where the DNA of Acleris celiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map1 country0

1. Forest & WoodlandPin Rigide - MixteForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.60 °C -3.80–13.7

Seasonal swing summer↔winter28.4 °C

Max temp (day)11.7 °C 1.20–18.6

Min temp (night)1.40 °C -8.50–9.30

Precipitation82.5 mm/mo 42.7–107

Air humidity57.1 % 54.7–63.2

Moisture balance1.90 mm/mo -39.6–52.5

Vapour deficit440 Pa 187–670

Wind speed3.40 m/s 2.70–4.10

Cloud cover49.6 % 44.9–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)