Achelous spinimanus

(Latreille, 1819) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Portunidae/Achelous

At a glance

Occurrence records3 278

Data sources7

Biological traits2

DNA specimens19

eDNA detections22

Sources7 archives

Databases and archives Achelous spinimanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility768 records↗

OBISOcean Biodiversity Information System2 510 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS3 278 records

Environmental DNA2 datasets · 2 countries22 detections

DNA & barcodingBOLD19 specimens

01Narrative

Achelous spinimanus is een krabbensoort uit de familie van de Portunidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1819 door Latreille.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achelous spinimanus has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections22

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

34Avariable

88Avariable

94Amostly conserved

112Tmostly conserved

119Gmostly conserved

122Gmostly conserved

127Tmostly conserved

139Cmostly conserved

160Amostly conserved

244Gvariable

280Gvariable

316Cvariable

328Tmostly conserved

466Amostly conserved

487Amostly conserved

511Amostly conserved

529Gvariable

538Gmostly conserved

540Tmostly conserved

547Tmostly conserved

548Tvariable

555Tmostly conserved

595Cmostly conserved

616Tmostly conserved

TACATTATATTTTATTTTTGGAGCTTGATCTGGAATAGTAGGAACTTCTCTAAGTCTTATTATTCGAGCAGAACTAGGGCAACCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes6

BIN1

Most divergent pair1.8%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achelous gibbesiisame genus9.9%Achelous spinicarpussame genus14.6%Charybdis rosaeasame family14.7%Trapezia bidentatasame order15.3%Achelous depressifronssame genus15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 278 records

Wild obs. + sensor2 279

Museum / vouchered985

Cultivated / captive8

Fossil6

Range

Area of Occupancy AOO4 656 km²

Depth

0–200 m sunlit2 225

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 9 m · max 393 m · 2 227 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 134≤1 km 112≤10 km 19>10 km 17

282 georeferenced · 1 997 without coordinates

Open the mapobservation + sensor2 279

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 49

56 georeferenced · 929 without coordinates

Open the institutions mapphysical evidence985

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	92
Washington, US	44
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	38
FCMMlocation not on record	11
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	7
Paris, FR	3
Masindi, UG	2
Montgomery, US	2
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2

10 institutions · 203 of 985 vouchered records shown · 300 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA22 detections

Where the DNA of Achelous spinimanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 18.1–25.3

Seasonal swing summer↔winter7.00 °C

Max temp (day)23.9 °C 21.5–28.5

Min temp (night)20.4 °C 12.9–24.2

Precipitation87.9 mm/mo 37.1–157

Air humidity60.4 % 57.9–65.4

Vapour deficit1,051 Pa 822–1,259

Cloud cover30.4 % 15.6–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achelous spinimanus

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type3 278 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 278 records