Achelous depressifrons

(Stimpson, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Portunidae/Achelous

At a glance

Occurrence records256

Data sources7

Biological traits4

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Achelous depressifrons's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

OBISOcean Biodiversity Information System107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS256 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Achelous depressifrons is een krabbensoort uit de familie van de Portunidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1859 door Stimpson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max93 m

Depth min0 m

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achelous depressifrons has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

5Tmostly conserved

22Gmostly conserved

29Tmostly conserved

34Gmostly conserved

73Amostly conserved

148Amostly conserved

319Amostly conserved

352Amostly conserved

382Amostly conserved

445Cmostly conserved

544Gmostly conserved

TACCTTATATTTTATTTTCGGGGCTTGATCAGGGATAGTTGGAACTTCACTAAGTCTTATTATTCGAGCAGAACTAGGACAACCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.84%

Haplotypes3

BIN1

Most divergent pair1.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scylla paramamosainsame family15.0%Cronius rubersame family15.1%Charybdis japonicasame family15.3%Charybdis helleriisame family15.3%Achelous spinimanussame genus15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type256 records

Wild obs. + sensor72

Museum / vouchered177

Fossil7

Range

Area of Occupancy AOO520 km²

Depth

0–200 m sunlit74

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 21.7 m · max 200 m · 74 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 38≤1 km 8≤10 km 4>10 km 4

54 georeferenced · 18 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
FCMMlocation not on record	7
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	4
Fundacion La Salle- Margarita- Venezuelalocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
Washington, US	1
	1

7 institutions · 28 of 177 vouchered records shown · 60 without an institution code

09Environmental DNA4 detections

Where the DNA of Achelous depressifrons was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 16.0–26.3

Seasonal swing summer↔winter11.8 °C

Max temp (day)25.9 °C 20.7–27.1

Min temp (night)23.6 °C 12.8–25.7

Precipitation96.4 mm/mo 83.9–105

Air humidity60.4 % 58.2–62.7

Vapour deficit1,217 Pa 872–1,284

Cloud cover30.8 % 23.0–34.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)