Achelous spinicarpus

Stimpson, 1871 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Portunidae/Achelous

At a glance

Occurrence records1 852

Data sources8

Biological traits2

DNA specimens17

eDNA detections12

Sources8 archives

Databases and archives Achelous spinicarpus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility668 records↗

OBISOcean Biodiversity Information System1 184 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 852 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD17 specimens

01Narrative

Achelous spinicarpus is een krabbensoort uit de familie van de Portunidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door Stimpson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achelous spinicarpus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

45Cmostly conserved

49Amostly conserved

65Cmostly conserved

69Cmostly conserved

70Tvariable

74Cmostly conserved

79Gvariable

82Amostly conserved

94Gmostly conserved

118Tmostly conserved

124Cmostly conserved

130Amostly conserved

181Tvariable

184Gmostly conserved

187Cmostly conserved

266Cmostly conserved

268Gmostly conserved

280Gmostly conserved

289Tmostly conserved

292Amostly conserved

310Avariable

319Tmostly conserved

331Gmostly conserved

352Amostly conserved

355Amostly conserved

373Amostly conserved

376Gvariable

382Cmostly conserved

385Cmostly conserved

397Cmostly conserved

400Cvariable

421Tmostly conserved

424Tvariable

433Gmostly conserved

448Amostly conserved

454Amostly conserved

469Amostly conserved

475Cmostly conserved

487Amostly conserved

493Gmostly conserved

496Gmostly conserved

505Cmostly conserved

508Avariable

517Gmostly conserved

535Gmostly conserved

536Tmostly conserved

556Tmostly conserved

580Amostly conserved

583Amostly conserved

625Avariable

TACATTATATTTTATTTTTGGAGCTTGATCAGGTATAGTAGGAACTTCATTAAGTCTTATTATCCGTGCTGAGCTAGGGCAACCAGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes6

BINs3

Most divergent pair4.0%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achelous gibbesiisame genus13.9%Achelous spinimanussame genus14.6%Cronius rubersame family15.0%Xaiva mcleayisame family15.7%Callinectes bocourtisame family16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 852 records

Wild obs. + sensor477

Museum / vouchered1 359

Cultivated / captive8

Fossil4

Other4

Range

Area of Occupancy AOO2 936 km²

Depth

0–200 m sunlit623

200–1000 m twilight40

1–4 km midnight0

>4 km abyssal0

median 62.1 m · max 521 m · 663 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 2≤1 km 2≤10 km 1>10 km 17

22 georeferenced · 455 without coordinates

Open the mapobservation + sensor477

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 14≤1 km 143

157 georeferenced · 1 202 without coordinates

Open the institutions mapphysical evidence1 359

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	85
Paris, FR	67
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	41
Washington, US	39
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	36
FCMMlocation not on record	34
Cambridge, US	4
Masindi, UG	3
Museu Paraense Emílio Goeldilocation not on record	1
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1

10 institutions · 311 of 1 359 vouchered records shown · 322 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Achelous spinicarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 20.7–23.7

Seasonal swing summer↔winter5.10 °C

Max temp (day)22.2 °C 21.2–25.2

Min temp (night)20.9 °C 20.1–21.9

Precipitation62.7 mm/mo 46.5–147

Air humidity64.6 % 59.1–67.8

Vapour deficit930 Pa 845–1,041

Cloud cover21.1 % 17.9–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achelous spinicarpus

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type1 852 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 852 records