Achaea lienardi

Boisduval, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records1 571

Data sources7

Biological traits0

DNA specimens264

eDNA detections260

Sources7 archives

Databases and archives Achaea lienardi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI260 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics264 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 571 records

Environmental DNA2 datasets · 12 countries260 detections

DNA & barcodingBOLD264 specimens

01Narrative

Achaea lienardi, or Lienard's achaea, is a fruit piercing moth of the family Erebidae first described by Jean Baptiste Boisduval in 1833. It is found in most countries in tropical Africa from Egypt to South Africa, including the islands of Madagascar, Réunion and Mauritius. The larva may feed on various plants, belonging to the genera Maerua, Pappea, Rhus, Citrus, Schotia, Sideroxylon, Ptaeroxylon, Acacia, Allophylus, Croton, Pinus and Ricinus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding264 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea lienardi has left across the world's sequence archives.

At a glance

DNA specimens264

BINs4

Marker genes1

eDNA detections260

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus260 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

136Cvariable

214Gvariable

556Amostly conserved

643Tmostly conserved

TTTATACTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes39

BINs4

Most divergent pair9.2%

AfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea catellasame genus3.5%Achaea catocaloidessame genus3.5%Achaea albiciliasame genus4.0%Achaea albifimbriasame genus4.0%Achaea illustratasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 571 records

Wild obs. + sensor1 482

Museum / vouchered89

Range

Area of Occupancy AOO2 712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 777≤1 km 215≤10 km 44>10 km 82

1 118 georeferenced · 364 without coordinates

Open the mapobservation + sensor1 482

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 4≤10 km 8

12 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	28
National Museums of Kenyalocation not on record	28
Tartu, EE	4
Museu Nacional de História Natural e da Ciêncialocation not on record	4
New Haven, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
ZSMlocation not on record	1
Forest Insect Museum Ibadan (FIMI)location not on record	1
Area de Conservacion Guanacastelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

10 institutions · 74 of 89 vouchered records shown · 15 without an institution code

09Environmental DNA260 detections

Where the DNA of Achaea lienardi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found260

Studies independent surveys2

Countries12

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 260 detections have coordinates

Open the map12 countries0

Knob Thorn/MarulaÂ SavannahMopaneÂ Shrubveld1. Forest & Woodland | 1.5. Subtropical/Trop…1. Forest & Woodland | 1.6. Subtropical/Trop…Thorn VeldAlluvial Plains

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 19.6–26.6

Seasonal swing summer↔winter9.90 °C

Max temp (day)29.7 °C 25.4–31.1

Min temp (night)20.4 °C 13.8–21.2

Precipitation120 mm/mo 12.5–158

Air humidity57.9 % 52.5–64.4

Moisture balance-48.5 mm/mo -100–6.70

Vapour deficit1,233 Pa 968–1,511

Wind speed2.10 m/s 2.00–3.20

Cloud cover70.3 % 15.4–70.8

CHELSA 1981–2010, ~9 km grid, at location & month of 255 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achaea lienardi

At a glance

Sources7 archives

At a glance

Record type1 571 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 571 records