Achaea catocaloides

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Achaea

At a glance

Occurrence records1 525

Data sources7

Biological traits0

DNA specimens77

eDNA detections83

Sources7 archives

Databases and archives Achaea catocaloides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 525 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI83 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 525 records

Environmental DNA1 datasets · 10 countries83 detections

DNA & barcodingBOLD77 specimens

01Narrative

Achaea catocaloides is a species of moth of the family Erebidae first described by Achille Guenée in 1852. It is found in Liberia, Guinea, Benin, Dahomey, Ivory Coast, Kenya and Uganda. There are up to two generations per year. In December 2008 and January 2009, there was a serious outbreak of in the border region of Liberia and Guinea, causing the Liberian government to declare a state of emergency. The feces of the caterpillars made local streams undrinkable.Lange, Karen (February 5, 2009). "Nightmarish Caterpillar Swarm Defies Control in Liberia". National Geographic News. Archived January 17, 2017. The larvae normally feed on various trees, but can become a pest on agricultural crops like coffee, cocoa, citrus, plantain, banana and cassava. The larvae, known as minsangula or lukunku in D.R. Congo and mindelemoka or muchangumuna in Congo Republic, are eaten and frequently sold in markets.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Achaea catocaloides has left across the world's sequence archives.

At a glance

DNA specimens77

BINs1

Marker genes1

eDNA detections83

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes7

BIN1

Most divergent pair0.30%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Achaea catellasame genus3.3%Achaea trapezoidessame genus3.5%Achaea lienardisame genus3.5%Achaea radamasame genus3.8%Achaea janatasame genus4.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 525 records

Wild obs. + sensor1 509

Museum / vouchered16

Range

Area of Occupancy AOO1 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 20≤1 km 7≤10 km 6

33 georeferenced · 1 476 without coordinates

Open the mapobservation + sensor1 509

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 8≤10 km 1

9 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FS-UDolocation not on record	8
Forest Insect Museum Ibadan (FIMI)location not on record	2
National Museums of Kenyalocation not on record	2
New Haven, US	1

4 institutions · 13 of 16 vouchered records shown · 3 without an institution code

09Environmental DNA83 detections

Where the DNA of Achaea catocaloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found83

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 83 detections have coordinates

Open the map10 countries0

Forest / savannah patchworkForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 22.4–26.4

Seasonal swing summer↔winter2.30 °C

Max temp (day)30.9 °C 27.2–30.9

Min temp (night)22.7 °C 18.0–23.4

Precipitation163 mm/mo 109–222

Air humidity65.2 % 63.1–70.2

Moisture balance12.8 mm/mo -62.1–84.7

Vapour deficit1,189 Pa 858–1,220

Wind speed1.10 m/s 0.7–2.50

Cloud cover49.6 % 25.0–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Achaea catocaloides

At a glance

Sources7 archives

At a glance

Record type1 525 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 525 records