Aceratagallia uhleri

(Van Duzee, 1894) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Aceratagallia

At a glance

Occurrence records12

Data sources4

Biological traits0

DNA specimens10

eDNA detections8

Sources4 archives

Databases and archives Aceratagallia uhleri's data was compiled from.

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD10 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aceratagallia uhleri has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.54%

Haplotypes2

BINs2

Most divergent pair2.0%

Where individuals differ — all 13 variable positions, in barcode order

37Gmostly conserved

94Cmostly conserved

199Amostly conserved

208Gmostly conserved

241Cmostly conserved

313Gmostly conserved

316Gvariable

340Tmostly conserved

344Tmostly conserved

427Amostly conserved

469Gmostly conserved

505Amostly conserved

527Gmostly conserved

AATATACTTTATTTTTGGTATATGGTCTGGAATAGTGGGTATAATATTAAGCATAATTATTCGAATTGAGCTTGGCCAACCAGGATCGTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aceratagallia sanguinolentasame genus6.2%Aceratagallia omanisame genus9.0%Aceratagallia pallidasame genus14.1%Agallia constrictasame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor1

Museum / vouchered11

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	6
Provo, US	5

2 institutions · 11 of 11 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Aceratagallia uhleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 5.00–21.1

Seasonal swing summer↔winter30.4 °C

Max temp (day)21.3 °C 11.8–28.3

Min temp (night)9.70 °C 1.50–16.0

Precipitation60.7 mm/mo 19.1–83.6

Air humidity54.7 % 50.8–56.8

Moisture balance-63.8 mm/mo -113–-27.7

Vapour deficit789 Pa 391–1,214

Wind speed4.50 m/s 2.70–5.30

Cloud cover43.5 % 26.5–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)