Aceratagallia sanguinolenta

(Provancher, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Aceratagallia

At a glance

Occurrence records22

Data sources4

Biological traits0

DNA specimens55

eDNA detections54

Sources4 archives

Databases and archives Aceratagallia sanguinolenta's data was compiled from.

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 2 countries54 detections

DNA & barcodingBOLD55 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aceratagallia sanguinolenta has left across the world's sequence archives.

At a glance

DNA specimens55

BINs3

Marker genes1

eDNA detections54

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

2Cmostly conserved

4Amostly conserved

5Tmostly conserved

6Amostly conserved

8Amostly conserved

9Cmostly conserved

13Amostly conserved

16Tmostly conserved

19Gmostly conserved

21Tmostly conserved

22Amostly conserved

23Tmostly conserved

24Amostly conserved

27Gmostly conserved

28Tmostly conserved

29Cmostly conserved

30Tmostly conserved

32Gmostly conserved

34Amostly conserved

39Amostly conserved

40Gmostly conserved

41Gmostly conserved

42Tmostly conserved

49Cmostly conserved

53Gmostly conserved

54Tmostly conserved

57Amostly conserved

64Cmostly conserved

65Gmostly conserved

66Amostly conserved

67Amostly conserved

71Amostly conserved

72Gmostly conserved

74Tmostly conserved

78Cmostly conserved

98Gmostly conserved

108Amostly conserved

168Amostly conserved

201Amostly conserved

204Gvariable

205Tmostly conserved

234Tmostly conserved

237Tmostly conserved

258Tmostly conserved

288Amostly conserved

315Tvariable

318Amostly conserved

321Gmostly conserved

327Tmostly conserved

336Gmostly conserved

339Cmostly conserved

342Tmostly conserved

345Tmostly conserved

346Cmostly conserved

351Cvariable

354Cmostly conserved

363Cmostly conserved

372Gmostly conserved

378Tmostly conserved

384Tmostly conserved

429Amostly conserved

477Gmostly conserved

507Gmostly conserved

540Tvariable

547Cvariable

570Cvariable

582Cvariable

600Cvariable

606Cvariable

609Tvariable

615Cmostly conserved

630Tvariable

637Amostly conserved

638Tmostly conserved

642Avariable

645Cmostly conserved

ACAATATACTTTATTTTTGGTATATGGTCTGGAATAGTAGGTATAATACTAAGTATAATTATTCGAATTGAGCTTGGCCAACCAGGATCG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes4

BINs3

Most divergent pair6.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aceratagallia uhlerisame genus6.2%Aceratagallia omanisame genus9.3%Aceratagallia pallidasame genus14.0%Ceratagallia nubilasame family15.4%Agallia barrettisame family17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor1

Museum / vouchered21

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 16>10 km 4

20 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	17
Natural History Museum of Utahlocation not on record	3
CUlocation not on record	1

3 institutions · 21 of 21 vouchered records shown

09Environmental DNA54 detections

Where the DNA of Aceratagallia sanguinolenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.1 Arable LandAgriculturalMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 6.20–18.4

Seasonal swing summer↔winter26.2 °C

Max temp (day)20.6 °C 10.6–21.5

Min temp (night)12.2 °C 1.90–16.2

Precipitation81.1 mm/mo 73.7–98.9

Air humidity59.8 % 55.1–60.3

Moisture balance-4.30 mm/mo -37.6–8.30

Vapour deficit718 Pa 426–839

Wind speed3.20 m/s 2.60–4.60

Cloud cover47.9 % 42.9–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)