Agallia constricta

Van Duzee, 1894 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Agallia

At a glance

Occurrence records1 861

Data sources5

Biological traits0

DNA specimens17

eDNA detections0

Sources5 archives

Databases and archives Agallia constricta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 861 records↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 861 records

DNA & barcodingBOLD17 specimens

01Narrative

Agallia constricta est une espèce d'insectes hémiptères de la famille des Cicadellidae, originaire des États-Unis. Cette cicadelle est un vecteur de phytovirus, notamment le virus des tumeurs de blessures (WTV) et le virus de la jaunisse nanisante de la pomme de terre (PYDV).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Agallia constricta has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

10Cmostly conserved

AACAATATACTTCATATTTGGTTTATGATCAGGAATAGTAGGAATAATATTAAGAGTTATTATTCGAATTGAATTAGGACAGCCAGGTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agallia barrettisame genus12.6%Agallia modestasame genus13.5%Agallia lineatasame genus14.2%Recilia coronifersame family15.8%Xestocephalus desertorumsame family15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 861 records

Wild obs. + sensor1 161

Museum / vouchered700

Range

Area of Occupancy AOO3 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 592≤1 km 148≤10 km 82>10 km 158

980 georeferenced · 181 without coordinates

Open the mapobservation + sensor1 161

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 20≤1 km 87≤10 km 304>10 km 5

416 georeferenced · 284 without coordinates

Open the institutions mapphysical evidence700

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	409
Mississippi State, US	153
University Park, US	42
North Carolina State University Insect Museumlocation not on record	31
University of Guelphlocation not on record	28
Cambridge, US	21
Provo, US	10
CUlocation not on record	1
Montgomery, US	1
US	1
University of Central Floridalocation not on record	1

11 institutions · 698 of 700 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Agallia constricta

At a glance

Sources5 archives

At a glance

Record type1 861 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 11 geolocated

Record type1 861 records