Acanthistius patachonicus

(Jenyns, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Serranidae/Acanthistius

At a glance

Occurrence records137

Data sources8

Biological traits4

DNA specimens14

eDNA detections21

Sources8 archives

Databases and archives Acanthistius patachonicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

OBISOcean Biodiversity Information System18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS137 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD14 specimens

01Narrative

Acanthistius patachonicus is een straalvinnige vissensoort uit de familie van zaag- of zeebaarzen (Serranidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1840 door Jenyns.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length31 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability27.82

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthistius patachonicus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

94Tmostly conserved

CCTGTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGCACAGCCCTAAGCCTGCTAATTCGGGCGGAACTTAGCCAACCGGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthistius pictussame genus13.2%Acanthistius cinctussame genus14.1%Pogonoperca punctatasame order14.3%Acanthistius joanaesame genus15.0%Etheostoma olmstedisame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor101

Museum / vouchered33

Other3

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 24≤1 km 11≤10 km 4>10 km 4

43 georeferenced · 58 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 14

16 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	3
Museu de Zoologia da Universidade de Sao Paulolocation not on record	3
CASlocation not on record	3
CENPAT-CONICETlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Buenos Aires, AR	1
PUC-RSlocation not on record	1
University of California San Diegolocation not on record	1
Chicago, US	1
Ann Arbor, US	1
Frankfurt am Main	1

11 institutions · 18 of 33 vouchered records shown · 4 without an institution code

09Environmental DNA21 detections

Where the DNA of Acanthistius patachonicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 11.9–16.8

Seasonal swing summer↔winter11.5 °C

Max temp (day)18.9 °C 13.3–20.7

Min temp (night)10.9 °C 9.30–14.6

Precipitation69.3 mm/mo 15.3–75.0

Air humidity58.3 % 52.6–60.0

Moisture balance-20.6 mm/mo

Vapour deficit782 Pa 584–938

Wind speed7.70 m/s

Cloud cover31.0 % 21.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)