Acanthistius joanae

Heemstra, 2010 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Serranidae/Acanthistius

At a glance

Occurrence records87

Data sources8

Biological traits6

DNA specimens21

eDNA detections20

Sources8 archives

Databases and archives Acanthistius joanae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

OBISOcean Biodiversity Information System31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS87 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD21 specimens

01Narrative

Acanthistius joanae is een straalvinnige vissensoort uit de familie van de zaag- of zeebaarzen (Serranidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 2010 door Phillip C. Heemstra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Other traits3

Depth max140 m

Depth min23 m

Vulnerability10

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthistius joanae has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

511Cmostly conserved

646Amostly conserved

CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCCCTAAGCCTGCTCATCCGAGCAGAACTTAGCCAACCCGGCGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes8

BIN1

Most divergent pair0.77%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthistius pictussame genus10.1%Acanthistius cinctussame genus10.7%Acanthistius ocellatussame genus10.8%Kyphosus bigibbussame order12.1%Oplegnathus conwayisame order12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type87 records

Wild obs. + sensor22

Museum / vouchered65

Range

Area of Occupancy AOO140 km²

Depth

0–200 m sunlit26

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 37.8 m · max 140 m · 26 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 5≤1 km 2≤10 km 5>10 km 5

17 georeferenced · 5 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 65 records without

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	29
Washington, US	1
Research Collection of Allan Connelllocation not on record	1

3 institutions · 31 of 65 vouchered records shown · 4 without an institution code

09Environmental DNA20 detections

Where the DNA of Acanthistius joanae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 19.4–21.6

Seasonal swing summer↔winter5.10 °C

Max temp (day)22.7 °C 20.6–22.8

Min temp (night)19.5 °C 16.8–20.5

Precipitation56.5 mm/mo 39.9–89.9

Air humidity60.4 % 58.9–62.7

Vapour deficit980 Pa 859–1,018

Cloud cover13.6 % 11.5–25.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)