Acanthistius pictus

(Tschudi, 1846) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Serranidae/Acanthistius

At a glance

Occurrence records168

Data sources8

Biological traits5

DNA specimens4

eDNA detections0

Sources8 archives

Databases and archives Acanthistius pictus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

OBISOcean Biodiversity Information System17 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS168 records

DNA & barcodingBOLD4 specimens

01Narrative

Acanthistius pictus is een straalvinnige vissensoort uit de familie van zaag- of zeebaarzen (Serranidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1846 door Johann Jakob von Tschudi. De soort staat op de Rode Lijst van de IUCN als niet bedreigd, beoordelingsjaar 2007. A. pictus komt voor in de oostelijke Stille Oceaan, en wordt aangetroffen aan de kust van zuidelijk Ecuador, Peru en tot in Centraal-Chili. Tschudi vond deze vis tijdens zijn reis in Zuid-Amerika op de markten van de Chileense havenstad Valparaíso.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length47 cm

Body mass1 862 g

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits1

Vulnerability37

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthistius pictus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

106Gmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTGCTCATTCGAGCAGAACTTAGCCAACCAGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthistius cinctussame genus7.7%Acanthistius ocellatussame genus7.9%Acanthistius joanaesame genus10.1%Parabembras robinsonisame order10.8%Scombrops boopssame order11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type168 records

Wild obs. + sensor135

Museum / vouchered33

Origin

Native1

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1>10 km 1

3 georeferenced · 132 without coordinates

Open the mapobservation + sensor135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 3≤10 km 1>10 km 4

10 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	5
Vancouver, CA	3
Paris, FR	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Cambridge, US	1
Helsinki, FI	1
CASlocation not on record	1
University of California San Diegolocation not on record	1
Los Angeles, US	1

9 institutions · 16 of 33 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)