Abralia veranyi

(Rüppell, 1844) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Enoploteuthidae/Abralia

At a glance

Occurrence records1 097

Data sources7

Biological traits7

DNA specimens12

eDNA detections2

Sources7 archives

Databases and archives Abralia veranyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility508 records↗

OBISOcean Biodiversity Information System589 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS1 097 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD12 specimens

01Narrative

Abralia veranyi is a species of squid in the family Enoploteuthidae. Common names include the eye-flash squid, Verany's enope squid and the midwater squid. It is found in the Atlantic Ocean and the Mediterranean Sea. It undergoes a daily vertical migration from deep waters to near the surface.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4.9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max900 m

Depth min1 m

Vulnerability10

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abralia veranyi has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P616 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 83 variable positions, in barcode order

14Tmostly conserved

19Amostly conserved

25Tmostly conserved

28Tmostly conserved

31Gmostly conserved

34Gmostly conserved

46Tvariable

79Gmostly conserved

85Amostly conserved

91Amostly conserved

96Cmostly conserved

118Amostly conserved

130Tmostly conserved

148Gmostly conserved

155Tmostly conserved

163Amostly conserved

169Amostly conserved

172Amostly conserved

187Amostly conserved

190Tmostly conserved

196Tmostly conserved

199Amostly conserved

217Tmostly conserved

220Amostly conserved

226Amostly conserved

229Cmostly conserved

235Cmostly conserved

238Amostly conserved

245Cmostly conserved

253Amostly conserved

262Tmostly conserved

265Gvariable

274Gmostly conserved

277Amostly conserved

280Gmostly conserved

286Amostly conserved

304Tmostly conserved

305Tmostly conserved

310Tmostly conserved

316Cmostly conserved

328Amostly conserved

331Amostly conserved

334Tmostly conserved

340Tmostly conserved

343Cmostly conserved

346Amostly conserved

355Tmostly conserved

359Cmostly conserved

361Amostly conserved

364Cmostly conserved

374Gmostly conserved

376Tmostly conserved

379Tmostly conserved

382Tmostly conserved

400Tmostly conserved

403Tmostly conserved

415Cmostly conserved

436Amostly conserved

437Cmostly conserved

460Amostly conserved

472Gmostly conserved

484Cmostly conserved

487Amostly conserved

499Amostly conserved

500Cmostly conserved

505Tmostly conserved

509Cmostly conserved

517Tmostly conserved

526Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Cmostly conserved

541Gvariable

556Tvariable

559Tmostly conserved

574Tmostly conserved

577Amostly conserved

586Avariable

589Tmostly conserved

595Amostly conserved

601Cmostly conserved

610Cmostly conserved

616Tvariable

AACATCCTTAAGATTAATAATTCGTACTGAGTTGGGTCAACCAGGTTCTTTACTTAACGATGATCAACTTTACAATGTGGTAGTAACTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes3

BINs3

Most divergent pair11.2%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abralia redfieldisame genus10.5%Abralia andamanicasame genus12.8%Pyroteuthis margaritiferasame order13.0%Pyroteuthis serratasame order13.8%Sepiola affinissame order14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 097 records

Wild obs. + sensor114

Museum / vouchered650

Other333

Origin

Native4

Range

Area of Occupancy AOO2 364 km²

Depth

0–200 m sunlit219

200–1000 m twilight317

1–4 km midnight7

>4 km abyssal0

median 295 m · max 2 587 m · 543 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 113 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9>10 km 1

10 georeferenced · 640 without coordinates

Open the institutions mapphysical evidence650

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	202
ICATMARlocation not on record	153
UM-RSMASlocation not on record	43
Delaware Museum of Nature and Sciencelocation not on record	21
The Atlantic reference Centrelocation not on record	12
Texas Cooperative Wildlife Collectionlocation not on record	4
ICM-CSIClocation not on record	2
IEOlocation not on record	2
New Haven, US	1
Cambridge, US	1
Philadelphia, US	1
IEO-COMA-CSIClocation not on record	1
South Kensington, GB	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

14 institutions · 445 of 650 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Abralia veranyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abralia veranyi

At a glance

Sources7 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type1 097 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 097 records