Abralia redfieldi

G.L.Voss, 1955 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Enoploteuthidae/Abralia

At a glance

Occurrence records283

Data sources5

Biological traits7

DNA specimens44

eDNA detections73

Sources5 archives

Databases and archives Abralia redfieldi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility164 records↗

OBISOcean Biodiversity Information System119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI73 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS283 records

Environmental DNA1 datasets · 3 countries73 detections

DNA & barcodingBOLD44 specimens

01Narrative

Abralia redfieldi is a species of enoploteuthid cephalopod ranging across the Atlantic Ocean from the waters of Nova Scotia to Argentina in the west, to the waters of western Africa south to South Africa in the east. It has been caught at depths of 50–100 m at night, and is preyed upon by dwarf sperm whales. It is similar in appearance to the Pacific Ocean species, Abralia similis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max720 m

Depth min1 m

Vulnerability10

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abralia redfieldi has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections73

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

5Gmostly conserved

11Amostly conserved

14Cmostly conserved

17Amostly conserved

20Amostly conserved

125Amostly conserved

149Cmostly conserved

182Cmostly conserved

206Gmostly conserved

239Gmostly conserved

290Amostly conserved

314Gmostly conserved

317Gmostly conserved

320Amostly conserved

344Tvariable

347Gmostly conserved

365Cmostly conserved

389Cmostly conserved

401Tmostly conserved

491Cmostly conserved

503Cmostly conserved

512Amostly conserved

524Gmostly conserved

525Tmostly conserved

527Amostly conserved

542Cmostly conserved

545Cmostly conserved

560Cmostly conserved

572Gmostly conserved

575Amostly conserved

581Tmostly conserved

587Tmostly conserved

597Tmostly conserved

TAATGATTCGAACCGAATTAGGTCAACCAGGTTCTTTACTTAACGATGATCAACTTTACAATGTAGTAGTGACTGCTCATGGATTTATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes35

BINs2

Most divergent pair11.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abralia veranyisame genus10.5%Abralia andamanicasame genus12.5%Pyroteuthis serratasame order14.6%Illex coindetiisame order15.2%Illex illecebrosussame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type283 records

Wild obs. + sensor37

Museum / vouchered246

Origin

Native1

Range

Area of Occupancy AOO648 km²

Depth

0–200 m sunlit40

200–1000 m twilight20

1–4 km midnight6

>4 km abyssal0

median 150 m · max 2 356.5 m · 66 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 37 records without

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 243 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	97
The Atlantic reference Centrelocation not on record	33
UM-RSMASlocation not on record	23
Cambridge, US	2
Saint John, CA	2
Texas Cooperative Wildlife Collectionlocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1

7 institutions · 159 of 246 vouchered records shown · 5 without an institution code

09Environmental DNA73 detections

Where the DNA of Abralia redfieldi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found73

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 73 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 20.8–25.4

Seasonal swing summer↔winter14.9 °C

Max temp (day)23.9 °C 21.8–26.4

Min temp (night)22.2 °C 19.8–24.6

Precipitation159 mm/mo 93.4–198

Air humidity63.3 % 61.6–67.8

Vapour deficit1,007 Pa 832–1,240

Cloud cover36.4 % 32.9–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)