Abralia andamanica

Goodrich, 1896 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Enoploteuthidae/Abralia

At a glance

Occurrence records150

Data sources8

Biological traits4

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Abralia andamanica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility91 records↗

OBISOcean Biodiversity Information System59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS150 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Abralia andamanica is a species of enoploteuthid cephalopod native to the Indian Ocean and Pacific Ocean. It is known from Australia, Indonesia, Japan and Hawaii. It is associated with shelf waters, and will rise to the upper water column at night to feed. Females spawn eggs 0.9–1.5 mm in diameter in gelatinous strings.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abralia andamanica has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P637 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)4.1%

Haplotypes2

BINs2

Most divergent pair0.78%

Where individuals differ — all 51 variable positions, in barcode order

16Avariable

28Tmostly conserved

55Cvariable

61Gmostly conserved

76Gmostly conserved

118Gmostly conserved

160Tmostly conserved

169Tmostly conserved

176Tmostly conserved

178Amostly conserved

191Cmostly conserved

199Tmostly conserved

211Tmostly conserved

214Cmostly conserved

220Gmostly conserved

223Gmostly conserved

245Tmostly conserved

266Cmostly conserved

304Gmostly conserved

316Amostly conserved

337Cmostly conserved

346Tmostly conserved

349Tmostly conserved

355Tmostly conserved

361Cmostly conserved

367Amostly conserved

379Tmostly conserved

391Amostly conserved

397Tmostly conserved

412Gmostly conserved

421Cmostly conserved

433Tmostly conserved

466Gmostly conserved

469Amostly conserved

487Tmostly conserved

521Cmostly conserved

527Cmostly conserved

544Amostly conserved

556Avariable

560Cmostly conserved

565Cmostly conserved

568Cmostly conserved

592Cmostly conserved

610Amostly conserved

616Cmostly conserved

618Tmostly conserved

622Amostly conserved

629Cmostly conserved

630Amostly conserved

632Tmostly conserved

634Gvariable

TATTTGATCAGGATTATTAGGTACATCTTTAAGATTAATAATCCGTACTGAACTCGGTCAGCCAGGTTCTTTATTGAATGATGATCAACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abralia redfieldisame genus12.5%Abralia veranyisame genus12.8%Pyroteuthis serratasame order13.8%Sepiola affinissame order14.1%Sepietta obscurasame order14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type150 records

Wild obs. + sensor17

Museum / vouchered133

Range

Area of Occupancy AOO388 km²

Depth

0–200 m sunlit3

200–1000 m twilight28

1–4 km midnight5

>4 km abyssal0

median 401 m · max 2 210 m · 36 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 16 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 5≤1 km 19>10 km 2

26 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	30
Paris, FR	19
Museums Victorialocation not on record	18
Washington, US	11
CASlocation not on record	3
Tasmanian Museum & Art Gallerylocation not on record	3
Sydney, AU	1
Chicago, US	1

8 institutions · 86 of 133 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Abralia andamanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–24.8

Seasonal swing summer↔winter1.10 °C

Max temp (day)27.7 °C

Min temp (night)21.5 °C

Precipitation321 mm/mo

Air humidity70.3 %

Moisture balance186 mm/mo

Vapour deficit925 Pa

Wind speed1.40 m/s

Cloud cover52.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)