Abagrotis nanalis

Grote, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records164

Data sources7

Biological traits0

DNA specimens22

eDNA detections21

Sources7 archives

Databases and archives Abagrotis nanalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility164 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF164 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD22 specimens

01Narrative

Abagrotis nanalis is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1881. It is found in North America from southern British Columbia east to southwest Saskatchewan and western North Dakota, south to northern New Mexico and California. The wingspan is about 25 mm. Adults are on wing from August to September in one generation in Alberta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis nanalis has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.01%

Haplotypes2

BIN1

Most divergent pair0.15%

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis vittifronssame genus2.1%Abagrotis duancasame genus2.4%Abagrotis turbulentasame genus2.4%Abagrotis dickelisame genus2.4%Abagrotis nefasciasame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type164 records

Wild obs. + sensor28

Museum / vouchered136

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 9≤1 km 2≤10 km 3>10 km 6

20 georeferenced · 8 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 16≤1 km 2≤10 km 6>10 km 2

26 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	71
Colorado State Universitylocation not on record	16
Oregon State Arthropod Collectionlocation not on record	16
East Lansing, US	7
Vernal, US	3
St. Paul, US	3
WWUlocation not on record	2
New Haven, US	1
Denver, US	1
Natural History Museum of Utahlocation not on record	1

10 institutions · 121 of 136 vouchered records shown · 15 without an institution code

09Environmental DNA21 detections

Where the DNA of Abagrotis nanalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.6 °C 15.3–21.0

Seasonal swing summer↔winter24.9 °C

Max temp (day)26.9 °C 22.1–28.1

Min temp (night)12.9 °C 10.1–14.5

Precipitation26.3 mm/mo 21.9–33.0

Air humidity51.6 % 48.6–55.2

Moisture balance-94.6 mm/mo -119–-40.0

Vapour deficit1,102 Pa 781–1,234

Wind speed2.50 m/s 1.80–2.70

Cloud cover34.6 % 31.1–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)