Volucella zonaria

(Poda, 1761) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Volucella

At a glance

Occurrence records96 066

Data sources9

Biological traits2

DNA specimens28

eDNA detections20

Sources9 archives

Databases and archives Volucella zonaria's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility96 066 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF96 066 records

Environmental DNA1 datasets · 7 countries20 detections

DNA & barcodingBOLD28 specimens

Genome at a glanceGoaT · NCBI≈1.3 Gbp

01Narrative

Volucella zonaria, the hornet mimic hoverfly, is a species of hoverfly. These flies are capable of buzz pollination.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)predator

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Volucella zonaria has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes2

eDNA detections20

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTCTTATTTGGTACTTGAGCAGGTATAGTAGGAACATCTTTAAGTATTTTAATTCGAGCAGAATTAGGACATCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Volucella pellucenssame genus2.3%Volucella nigroabdominalissame genus6.6%Volucella evectasame genus6.7%Volucella bombylanssame genus6.8%Volucella facialissame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Volucella zonaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 262 783 537 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Volucella zonaria1.26 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness90.6% BUSCO

08Occurrence & distribution

Record type96 066 records

Wild obs. + sensor95 818

Museum / vouchered244

Other4

Origin

Native62

Range

Area of Occupancy AOO94 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 29 788≤1 km 5 331≤10 km 43 846>10 km 765

79 730 georeferenced · 16 088 without coordinates

Open the mapobservation + sensor95 818

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 34≤1 km 50≤10 km 18>10 km 2

104 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CIBIOlocation not on record	74
Natural History Museum Rotterdamlocation not on record	23
Tilburg, NL	22
Helsinki, FI	11
NMOKlocation not on record	9
Nijmegen, NL	7
MZLUlocation not on record	5
SLU Artdatabankenlocation not on record	5
ZSMlocation not on record	4
Philadelphia, US	4
Bavarian State Collection of Zoologylocation not on record	4
Uniwersytet Łódzkilocation not on record	3
UFPRlocation not on record	3
NHMOlocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Provincia di Livornolocation not on record	2
Ataturk Universitylocation not on record	2
DFFW2016location not on record	2
Gothenburg, SE	1
Barcelona, ES	1
DFFW1981location not on record	1
Ugentlocation not on record	1
Salzburg, AT	1
Radicondoli, IT	1

24 institutions · 191 of 244 vouchered records shown · 53 without an institution code

09Environmental DNA20 detections

Where the DNA of Volucella zonaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map7 countries0

Alpine meadowscoastal dunes3. Shrubland|3.8. Shrubland - Mediterranean-…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 16.5–21.4

Seasonal swing summer↔winter17.0 °C

Max temp (day)22.4 °C 20.4–25.3

Min temp (night)14.5 °C 11.0–18.6

Precipitation59.6 mm/mo 28.2–162

Air humidity60.3 % 51.3–62.8

Moisture balance-58.4 mm/mo -135–87.6

Vapour deficit911 Pa 655–1,176

Wind speed3.00 m/s 2.00–3.50

Cloud cover34.5 % 22.0–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Volucella zonaria

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type96 066 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type96 066 records