Volucella facialis

Williston, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Volucella

At a glance

Occurrence records316

Data sources4

Biological traits0

DNA specimens18

eDNA detections8

Sources4 archives

Databases and archives Volucella facialis's data was compiled from.

GBIFGlobal Biodiversity Information Facility316 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF316 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD18 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Volucella facialis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

14Amostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

34Amostly conserved

36Tmostly conserved

37Amostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

43Tmostly conserved

44Amostly conserved

45Cmostly conserved

46Cmostly conserved

47Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Tmostly conserved

52Amostly conserved

54Gmostly conserved

55Amostly conserved

57Tmostly conserved

61Amostly conserved

69Cmostly conserved

106Cmostly conserved

161Gmostly conserved

266Cmostly conserved

271Tmostly conserved

300Gmostly conserved

368Gmostly conserved

403Tvariable

415Tmostly conserved

433Amostly conserved

518Amostly conserved

616Tmostly conserved

634Cmostly conserved

AACATTATATTTCATATTTGGAACATGAGCTGGAATAGTAGGTACCTCATTAAGAATTTTAATTCGAGCAGAATTAGGACATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes4

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Volucella evectasame genus1.8%Volucella nigroabdominalissame genus1.9%Volucella inanissame genus5.6%Volucella nigricanssame genus6.7%Volucella zonariasame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type316 records

Wild obs. + sensor224

Museum / vouchered92

Origin

Native1

Range

Area of Occupancy AOO832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 135≤1 km 30≤10 km 6>10 km 7

178 georeferenced · 46 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 54≤1 km 3≤10 km 10>10 km 3

70 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	65
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	7
Cambridge, US	4
Saint John, CA	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
WIlocation not on record	1
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Los Angeles, US	1
Champaign, US	1

10 institutions · 85 of 92 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Volucella facialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.50–16.4

Seasonal swing summer↔winter30.9 °C

Max temp (day)12.4 °C 10.4–20.7

Min temp (night)10.0 °C 1.30–11.2

Precipitation88.5 mm/mo 64.1–141

Air humidity59.9 % 59.4–71.3

Moisture balance10.4 mm/mo

Vapour deficit495 Pa 377–746

Wind speed4.00 m/s

Cloud cover54.2 % 39.8–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)