Trypoxylon scutatum

Chevrier, 1867 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Crabronidae/Trypoxylon

At a glance

Occurrence records58

Data sources6

Biological traits0

DNA specimens16

eDNA detections15

Sources6 archives

Databases and archives Trypoxylon scutatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 4 countries15 detections

DNA & barcodingBOLD16 specimens

01Narrative

Trypoxylon scutatum is a predatory wasp in the family Crabronidae.BioLib

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypoxylon scutatum has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

157Tmostly conserved

172Cmostly conserved

178Cvariable

193Cmostly conserved

197Tmostly conserved

235Cvariable

278Amostly conserved

280Gvariable

310Cmostly conserved

313Amostly conserved

340Cvariable

359Tmostly conserved

361Amostly conserved

370Gvariable

430Amostly conserved

445Tmostly conserved

448Tmostly conserved

469Cmostly conserved

548Tmostly conserved

559Amostly conserved

589Cmostly conserved

610Cvariable

622Avariable

631Amostly conserved

AATATTATATTTTTTATTTGCAATTTGATCAGGAATAGTAGGAACATCATTAAGAATAATTATTCGAATAGAATTAGGAACAGTAACTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes3

BINs3

Most divergent pair2.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypoxylon kostylevisame genus10.6%Trypoxylon clavicerumsame genus10.6%Trypoxylon kolazyisame genus11.0%Trypoxylon carinatumsame genus11.9%Trypoxylon bidentatumsame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor23

Museum / vouchered35

Range

Area of Occupancy AOO176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 14≤10 km 8

22 georeferenced · 1 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 7≤10 km 11>10 km 1

20 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	7
ZSMlocation not on record	4
NMOKlocation not on record	4
Barcelona, ES	2
Provincia di Livornolocation not on record	2
Champaign, US	2
Bonn, DE	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
IMEDEAlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

11 institutions · 28 of 35 vouchered records shown · 7 without an institution code

09Environmental DNA15 detections

Where the DNA of Trypoxylon scutatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 14.8–26.6

Seasonal swing summer↔winter13.3 °C

Max temp (day)24.8 °C 19.2–31.2

Min temp (night)21.2 °C 8.70–22.4

Precipitation3.60 mm/mo 0.7–63.3

Air humidity59.0 % 55.2–67.0

Moisture balance-156 mm/mo -170–-65.1

Vapour deficit1,101 Pa 751–1,391

Wind speed2.10 m/s 1.80–3.00

Cloud cover26.1 % 4.70–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)