Trypoxylon clavicerum

Lepeletier de Saint Fargeau & Audinet-Serville, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Crabronidae/Trypoxylon

At a glance

Occurrence records2 640

Data sources9

Biological traits2

DNA specimens116

eDNA detections440

Sources9 archives

Databases and archives Trypoxylon clavicerum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 640 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI440 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics116 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 640 records

Environmental DNA3 datasets · 19 countries440 detections

DNA & barcodingBOLD116 specimens

Genome at a glanceGoaT · NCBI≈271 Mbp

01Narrative

Trypoxylon clavicerum is a Palearctic species of solitary wasp.BWARSEdward Saunders 1896, The Hymenoptera Aculeata of the British Isles London. pdf us.archive Full text with illustrations

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding116 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypoxylon clavicerum has left across the world's sequence archives.

At a glance

DNA specimens116

BINs1

Marker genes1

eDNA detections440

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus101 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

50Tmostly conserved

64Tmostly conserved

130Cmostly conserved

197Cvariable

250Tmostly conserved

271Cmostly conserved

278Tvariable

313Amostly conserved

340Tvariable

346Amostly conserved

382Amostly conserved

494Gmostly conserved

514Avariable

536Tmostly conserved

613Cmostly conserved

658Tvariable

AATATTATATTTTTTATTTGCAATATGAGCAGGAATAATTGGTACATCATTAAGAATAATTATTCGAATAGAATTAGGAACAGTTACACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes9

BIN1

Most divergent pair2.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypoxylon kolazyisame genus4.9%Trypoxylon bidentatumsame genus9.0%Trypoxylon deceptoriumsame genus9.1%Trypoxylon figulussame genus9.4%Trypoxylon petiolatumsame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Trypoxylon clavicerum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈270 886 707 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Trypoxylon clavicerum0.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness94.9% BUSCO

08Occurrence & distribution

Record type2 640 records

Wild obs. + sensor1 074

Museum / vouchered1 548

Other18

Range

Area of Occupancy AOO5 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 610≤1 km 174≤10 km 217

1 001 georeferenced · 73 without coordinates

Open the mapobservation + sensor1 074

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 239≤1 km 588≤10 km 461>10 km 10

1 298 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence1 548

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	499
Helsinki, FI	331
SLU Artdatabankenlocation not on record	135
Philadelphia, US	82
Zürich, CH	82
Natural History Museum Rotterdamlocation not on record	57
NMOKlocation not on record	37
Trondheim, NO	23
Bonn, DE	22
ZSMlocation not on record	19
NCMGlocation not on record	15
Tilburg, NL	10
University of Guelphlocation not on record	8
Bavarian State Collection of Zoologylocation not on record	8
Uniwersytet Łódzkilocation not on record	7
Metsähallituslocation not on record	5
Gothenburg, SE	4
BioFokuslocation not on record	4
MZLUlocation not on record	3
NHMOlocation not on record	2
ZMAAlocation not on record	2
WIlocation not on record	2
CBDClocation not on record	1
US	1
Toronto, CA	1
Adam Mickiewicz University in Poznańlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1
Champaign, US	1
Tartu, EE	1
neflocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
UGRlocation not on record	1

33 institutions · 1 368 of 1 548 vouchered records shown · 180 without an institution code

09Environmental DNA440 detections

Where the DNA of Trypoxylon clavicerum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found440

Studies independent surveys3

Countries19

Verifiable raw sequence linked113

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 440 detections have coordinates

Open the map19 countries0

14. Artificial - Terrestrial|14.5 Urban AreasForestChablis chenaie1. Forest & Woodland|1.4. Temperate ForestUrban1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 13.2–21.2

Seasonal swing summer↔winter20.2 °C

Max temp (day)21.0 °C 17.6–28.8

Min temp (night)12.0 °C 8.60–14.9

Precipitation73.4 mm/mo 23.3–99.6

Air humidity59.1 % 45.0–61.5

Moisture balance-51.0 mm/mo -155–-10.5

Vapour deficit794 Pa 625–1,295

Wind speed2.80 m/s 2.20–4.10

Cloud cover40.1 % 29.5–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 428 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trypoxylon clavicerum

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 640 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 640 records