Tiracola plagiata

(Walker, 1857) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Tiracola

At a glance

Occurrence records436

Data sources7

Biological traits0

DNA specimens52

eDNA detections52

Sources7 archives

Databases and archives Tiracola plagiata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility436 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF436 records

Environmental DNA1 datasets · 7 countries52 detections

DNA & barcodingBOLD52 specimens

01Narrative

Tiracola plagiata, the cacao armyworm, is a moth of the family Noctuidae. The species was first described by Francis Walker in 1857. It is found from south-east Asia, South India, Sri Lanka, Myanmar to the South Pacific Islands, including the northern two-thirds of Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tiracola plagiata has left across the world's sequence archives.

At a glance

DNA specimens52

BINs6

Marker genes2

eDNA detections52

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

22Tvariable

49Cvariable

50Tvariable

58Amostly conserved

82Tvariable

100Amostly conserved

145Tmostly conserved

154Cvariable

193Tmostly conserved

205Cvariable

211Amostly conserved

220Cvariable

223Cvariable

226Tmostly conserved

235Cmostly conserved

238Tvariable

241Amostly conserved

256Tmostly conserved

271Cvariable

274Tvariable

283Tvariable

304Cvariable

364Tmostly conserved

386Cmostly conserved

391Tvariable

397Cvariable

400Cmostly conserved

401Cvariable

403Amostly conserved

412Cvariable

418Tmostly conserved

436Tvariable

451Tmostly conserved

460Tmostly conserved

490Tvariable

514Tvariable

541Tmostly conserved

556Tmostly conserved

571Tmostly conserved

586Avariable

595Tmostly conserved

601Tmostly conserved

607Cmostly conserved

616Cvariable

622Amostly conserved

643Tmostly conserved

652Tvariable

TACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes15

BINs6

Most divergent pair5.6%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tiracola aureatasame genus3.3%Actebia violettasame family5.5%Actebia fugaxsame family5.8%Protogygia biclavissame family5.9%Graphiphora augursame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_062090 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type436 records

Wild obs. + sensor196

Museum / vouchered240

Origin

Native12

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 64≤1 km 90≤10 km 6>10 km 5

165 georeferenced · 31 without coordinates

Open the mapobservation + sensor196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 5≤10 km 6>10 km 2

13 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence240

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taiwan Forestry Research Institutelocation not on record	87
Mangilao, GU	66
Helsinki, FI	20
SUVlocation not on record	12
DPIlocation not on record	11
Auckland, NZ	10
Natick, US	9
Museums Victorialocation not on record	9
Ciudad de México, MX	5
PUC-RSlocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
New Zealand Arthropod Collectionlocation not on record	1

12 institutions · 235 of 240 vouchered records shown · 4 without an institution code

09Environmental DNA52 detections

Where the DNA of Tiracola plagiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map7 countries0

UrbanDry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.1–25.9

Seasonal swing summer↔winter7.30 °C

Max temp (day)26.5 °C 22.6–28.6

Min temp (night)19.0 °C 16.5–25.2

Precipitation142 mm/mo 87.3–325

Air humidity62.6 % 58.9–70.2

Moisture balance18.9 mm/mo -50.1–255

Vapour deficit1,009 Pa 743–1,166

Wind speed2.40 m/s 1.00–5.70

Cloud cover30.2 % 18.3–58.6

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)