Tiracola aureata

Holloway, 1989 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Tiracola

At a glance

Occurrence records2 229

Data sources7

Biological traits0

DNA specimens48

eDNA detections79

Sources7 archives

Databases and archives Tiracola aureata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 229 records

Environmental DNA1 datasets · 11 countries79 detections

DNA & barcodingBOLD48 specimens

01Narrative

Tiracola aureata is a moth of the family Noctuidae first described by Jeremy Daniel Holloway in 1989. It is found from India and from China to Sundaland.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tiracola aureata has left across the world's sequence archives.

At a glance

DNA specimens48

BINs3

Marker genes2

eDNA detections79

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

1Tmostly conserved

22Tmostly conserved

25Tvariable

58Avariable

82Tmostly conserved

100Tmostly conserved

145Cmostly conserved

154Cmostly conserved

193Cmostly conserved

202Gvariable

211Amostly conserved

220Cvariable

223Cmostly conserved

226Tvariable

238Tmostly conserved

241Amostly conserved

274Cmostly conserved

283Tmostly conserved

304Cmostly conserved

364Tmostly conserved

382Gvariable

386Tmostly conserved

400Tvariable

401Cmostly conserved

403Avariable

412Cmostly conserved

418Cmostly conserved

448Cvariable

451Cmostly conserved

460Tmostly conserved

490Tmostly conserved

499Tmostly conserved

514Tmostly conserved

556Tvariable

562Cvariable

571Tvariable

595Tmostly conserved

601Tvariable

607Tmostly conserved

610Tvariable

616Tvariable

619Tvariable

622Tmostly conserved

637Cvariable

640Cvariable

643Cmostly conserved

TACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes11

BINs3

Most divergent pair6.1%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tiracola plagiatasame genus3.3%Feliniopsis connivenssame family6.1%Lithophane baileyisame family6.5%Actebia praecoxsame family6.8%Cerastis cornutasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_062103 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type2 229 records

Wild obs. + sensor1 878

Museum / vouchered351

Range

Area of Occupancy AOO2 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 102≤1 km 52≤10 km 29>10 km 25

208 georeferenced · 1 670 without coordinates

Open the mapobservation + sensor1 878

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 350 without coordinates

Open the institutions mapphysical evidence351

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	302
Helsinki, FI	43
Hiwa Museum of Natural Historylocation not on record	1
HUNMlocation not on record	1

4 institutions · 347 of 351 vouchered records shown · 4 without an institution code

09Environmental DNA79 detections

Where the DNA of Tiracola aureata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map11 countries0

Subtropical forest1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 15.7–25.3

Seasonal swing summer↔winter2.00 °C

Max temp (day)22.2 °C 18.5–28.7

Min temp (night)14.2 °C 11.3–21.8

Precipitation237 mm/mo 43.9–352

Air humidity66.4 % 61.7–72.0

Moisture balance99.3 mm/mo -48.2–243

Vapour deficit747 Pa 522–1,088

Wind speed1.50 m/s 0.9–2.40

Cloud cover49.6 % 23.7–72.4

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tiracola aureata

At a glance

Sources7 archives

At a glance

Record type2 229 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 229 records